TY  - GEN
T1  - New alleles of C. elegans gene cls-2 (R107.6), called xc3, xc4, and xc5
AU  - Munoz, Nicholas R.
AU  - Black, Christopher J.
AU  - Young, Ethan T.
AU  - Chu, Diana S.
DO  - 10.17912/W2RQ2X
UR  - http://beta.micropublication.org/journals/biology/w2rq2x/
AB  - We have generated novel mutant alleles, named xc3, xc4, and xc5, of the gene cls-2 (R107.6) that encode one of the three predicted orthologs of mammalian CLASPs and of Drosophila ORBIT/MAST, microtuble-binding proteins (Akhmanova et al., 2001; Maiato et al., 2002). In C. elegans CLS-2 is required for meiosis and mitosis (Cheeseman et al., 2005; Dumont et al., 2010; Espiritu et al., 2012; Maton et al., 2015; Nahaboo et al., 2015). The alleles were isolated from gene mutations generated by Non-Homologous End Joining (NHEJ) mediated repair of Cas9-generated breaks (Dickinson et al., 2013; Ran et al., 2013). The alleles were detected by PCR using the following primers, 5’- CGATACGTCGGAGCAGAGC -3’ and 5’- CGGGGGTCGAAAATCATAAGG -3’. Next Generation Sequencing allowed us to identify 30 bp flanking sequences of the alleles xc3, xc4, and xc5 as TTGTCCAAGTCTACGTCAATCGGGCAATGT – [42 bp deletion] – AGCCCATAATTCCCCCGTATTCGTATCCCA, TCTACGTCAATCGGGCAATGTCGTCCAGTT – [3 bp deletion, 41 bp insertion (GGTCTGAATGACTTTCGCACTATTCCCCTATTCGCACGCCT)] – ATTCGCACGTATGATTCGTCGTTGCAATGT, and AACCTTGTCCAAGTCTACGTCAATCGGGCA – [111 bp deletion ] – TCATCCCTTCACTTTGTAATATAATTTTAT,  respectively.
PY  - 2017
JO  - microPublication Biology
ER  -