TY  - GEN
T1  - Two novel alleles in C. elegans mir-1822 gene.
AU  - Anderson, Marcy
AU  - Mash, Maddy
AU  - Haskell, Dustin
AU  - Hebbar, Shilpa
AU  - Zinovyeva, Anna Y
DO  - 10.17912/micropub.biology.000212
UR  - http://beta.micropublication.org/journals/biology/micropub-biology-000212/
AB  - microRNAs are small noncoding RNAs of ~22 nucleotides in length that regulate gene expression by degrading target mRNAs or inhibiting their translation. To our knowledge mir-1822 currently lacks deletion alleles, impeding mir-1822 functional characterization. We generated two new deletions of the C. elegans mir-1822 locus, using the CRISPR-Cas9 genome editing technique. The following mir-1822 specific Alt-R crRNAs were ordered from IDT: gRNA1, 5’-AGTTTCTCTGGGAAAGCTAT-3’ and gRNA2: 5’-TGAGCCAAGAGTTTTTCTGA-3’. To create the deletions, Cas9 (Alt-R Cas9, IDT) was loaded with the two mir-1822 guide RNAs, dpy-10 guide RNA (Arribere et al, 2014) (IDT), and tracer RNA (IDT) and the mixture was injected into C. elegans. The resulting progeny were screened for CRISPR-Cas9 positive animals as previously described (Arribere et al, 2014). The following PCR primers were used to screen for deletions of interest: mir-1822.for1: 5’- CGGAAGGACACCTGCCACCAATG-3’ and mir-1822.rev1: 5’- GAGGGCAATCTTCTTCTGGTCGCC -3’.
PY  - 2020
JO  - microPublication Biology
ER  -