microPublication

Get Your Data Out, Be Cited

microPublication / Biology / Expression pattern of endogenous PAR-4A...
Expression pattern of endogenous PAR-4A & C after CRISPR/Cas9-mediated genome editing
Vincent Roy1, Olivier Gagné2, Karim Hamiche3, Jean-Claude Labbé3 and Patrick Narbonne1, 2
1Département de Biologie Moléculaire, de Biochimie Médicale et de Pathologie, Faculté de Médecine, Université Laval, Québec, Canada.
2Département de Biologie Médicale, Université du Québec à Trois-Rivières, Trois-Rivières, Canada.
3Département de Pathologie et Biologie Cellulaire, Institut de Recherche en Immunologie et en Cancérologie (IRIC), Université de Montréal, Montréal, Canada.
Correspondence to: Patrick Narbonne (Patrick.Narbonne@uqtr.ca)
Figure 1. mNG::PAR-4A & C are ubiquitously expressed, excluded from nuclei and enriched at the cell cortex.: (A) Schematic depiction of par-4 locus organization and the predicted transcripts from this gene before editing (top), after homologous recombination (middle), and after SEC removal (bottom). Adapted from (Dickinson et al. 2015). (B-E) Fluorescence micrographs (B, D) and pseudo-DIC/fluorescence-merge micrographs (C, E) of wild-type (N2) animals and mNG::par-4a & c animals taken with the same settings, 24 hours (25°C) after the late L4 stage. (F) Fluorescence micrograph showing a close-up of the germ line of a mNG::par-4a & c animal. (G) Fluorescence micrographs of 1- and 4-cell mNG::par-4a & c embryos. Scale bars: B-E, 80 mM; F, 55 mM; G, 27 mM. (H) Maternal effect embryonic lethality of the indicated genotypes at 25°C.

Description

PAR-4/LKB1 is maternally expressed and required for the asymmetrical distribution of early embryonic determinants and viability in C. elegans (Morton et al. 1992; Watts et al. 2000; Tenlen et al. 2008). It is also implicated in a variety of postembryonic processes, including germline stem cell quiescence (Narbonne and Roy 2006; Narbonne et al. 2017), neuronal growth and polarity (Kim et al. 2010; Teichmann and Shen 2011), cytoskeletal rearrangements (Narbonne et al. 2010; Chartier et al. 2011), and metabolism (Narbonne and Roy 2009). Its expression pattern and subcellular localization has been determined in fixed animals by antibody staining (Watts et al. 2000). Here, we used CRISPR/Cas9-mediated genome editing to fluorescently label the two longest endogenous PAR-4 isoforms, PAR-4A and PAR-4C, with monomeric Neon Green (mNG) (Shaner et al. 2013), using the self-excising cassette (SEC) system (Dickinson et al. 2015) (Fig. 1A). We found ubiquitous mNG::par-4a & c expression and cytoplasmic and cortical enrichment of mNG::PAR-4A & C proteins in the germ line and early embryos (Fig. 1B-H), as previously described (Watts et al. 2000). Interestingly, we find that mNG::PAR-4A & C cortical enrichment is transiently lost in the pachytene area of the germ line (Fig. 1F), although it remains unclear whether this is functionally relevant.

The intermediate strain that still contains the SEC (Dickinson et al. 2015) is predicted to be null for par-4a & c, potentially leaving the shorter par-4b isoform functional. To evaluate the requirement for par-4a & c we examined the embryonic lethality (at 25°C) of the generated SEC-containing and SEC-excised strains. We found that the self-progeny of homozygous SEC-containing (e.g. par-4a & c null) animals is viable (Fig. 1H). This suggests that par-4b alone is sufficient to establish embryonic polarity and sustain the essential function of par-4. Consistent with this, to our knowledge, all existing par-4 alleles that impair embryonic development disrupt par-4b (Morton et al. 1992; Watts et al. 2000).

Reagents

Nematodes were cultured on standard NGM plates with E. coli (OP50) and maintained at 15 °C unless otherwise specified. N2 (Bristol) was used as wild-type. The following strains were also used: KK300: par-4(it57)V, UTR43: par-4(nar12[Ppar-4a::mNG + loxP sqt-1(gf) Hygromycin (+) loxP 3X FLAG])V, UTR45: par-4(nar13[mNG :: par-4a & c])V. UTR43 and UTR45 will be made available through the CGC.

pDD162 was modified as described (Paix et al. 2014) to generate two sgRNAs using the following primers (all 5’->3’): fwd Q5 1 gtgctcccgaggatgtcgagttttagagctagaaatagcaagt and fwd Q5 2 atgctccgtcgacatcctcgttttagagctagaaatagcaagt. pDD268 was modified as described (Dickinson et al. 2015) to generate the N-terminal mNG::SEC repair template using the following primers: 5’ arm par-4 fwd acgttgtaaaacgacggccagtcgccggcaatttggtcgtttttggggtt, 5’ arm par-4 rev catgttgtcctcctctcccttggagaccattgaagagagctctgaaattttt, 3’ arm par-4 fwd cgtgattacaaggatgacgatgacaagagaatggacgcaccgtcaacttcatcaggagcacaaagcaaacttctg, and 3’ arm par-4 rev tcacacaggaaacagctatgaccatgttatttccgaaaattgaacgattttt. Modified vector DNA sequences were confirmed by Sanger sequencing. The two sgRNA guide vectors were microinjected together with the repair template in wild-type animals that had been subjected to cku-80(RNAi) (Ward 2015) and a single par-4 CRISPRed line was obtained; the SEC was excised as described (Dickinson et al. 2015).

All images were acquired from paralyzed live animals (0.1% W/V tetramizole in M9) with a Leica SP8 confocal microscope using the same parameters and were processed identically. Whole animals were stitched (Preibisch et al. 2009) and straightened using ImageJ.

Acknowledgments

We thank Dan Dickinson and Bob Goldstein for providing pDD268 and the CGC (funded by NIH Office of Infrastructure Programs P40 OD010440) for strains.

References

Chartier, N. T., D. P. Salazar Ospina, L. Benkemoun, M. Mayer, S. W. Grill et al., PAR-4/LKB1 mobilizes nonmuscle myosin through anillin to regulate C. elegans embryonic polarization and cytokinesis. Curr Biol 2011 21: 259-269.
PubMed
Dickinson, D. J., A. M. Pani, J. K. Heppert, C. D. Higgins and B. Goldstein, Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 2015 200: 1035-1049. PMID 4574250
PubMed
Kim, J. S., W. Hung, P. Narbonne, R. Roy and M. Zhen, C. elegans STRADalpha and SAD cooperatively regulate neuronal polarity and synaptic organization. Development 2010 137: 93-102.
PubMed
Morton, D. G., J. M. Roos and K. J. Kemphues, par-4, a gene required for cytoplasmic localization and determination of specific cell types in Caenorhabditis elegans embryogenesis. Genetics 1992 130: 771-790. PMID 1204928
PubMed
Narbonne, P., V. Hyenne, S. Li, J. C. Labbe and R. Roy, Differential requirements for STRAD in LKB1-dependent functions in C. elegans. Development 2010 137: 661-670.
PubMed
Narbonne, P., P. S. Maddox and J. C. Labbe, DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLoS Genet 2017 13: e1006738.
PubMed
Narbonne, P., and R. Roy, Inhibition of germline proliferation during C. elegans dauer development requires PTEN, LKB1 and AMPK signalling. Development 2006 133: 611-619.
PubMed
Narbonne, P., and R. Roy, Caenorhabditis elegans dauers need LKB1/AMPK to ration lipid reserves and ensure long-term survival. Nature 2009 457: 210-214.
PubMed
Paix, A., Y. Wang, H. E. Smith, C. Y. Lee, D. Calidas et al., Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 2014 198: 1347-1356.
PubMed
Preibisch, S., S. Saalfeld and P. Tomancak, Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics 2009 25: 1463-1465.
PubMed
Shaner, N. C., G. G. Lambert, A. Chammas, Y. Ni, P. J. Cranfill et al., A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum. Nat Methods 2013 10: 407-409. PMID 3811051
PubMed
Teichmann, H. M., and K. Shen, UNC-6 and UNC-40 promote dendritic growth through PAR-4 in Caenorhabditis elegans neurons. Nat Neurosci 2011 14: 165-172. PMID 3908881
PubMed
Tenlen, J. R., J. N. Molk, N. London, B. D. Page and J. R. Priess, MEX-5 asymmetry in one-cell C. elegans embryos requires PAR-4- and PAR-1-dependent phosphorylation. Development 2008 135: PMID 3665-3675.
PubMed
Ward, J. D., Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair. Genetics 2015 199: 363-377.
PubMed
Watts, J. L., D. G. Morton, J. Bestman and K. J. Kemphues, The C. elegans par-4 gene encodes a putative serine-threonine kinase required for establishing embryonic asymmetry. Development 2000 127: 1467-1475.
PubMed

Funding

This work was funded by CIHR grant PJT-153283 to JCL, and FRQ-NT (NC-205752) and CFI (36916) grants to PN. PN is a Junior 1 FRQ-S Research Scholar.

Reviewed By

Anonymous

History

Received: October 11, 2018
Accepted: November 12, 2018
Published: November 13, 2018

Copyright

© 2018 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Roy, V; Gagné, O; Hamiche, K; Labbé, JC; Narbonne, P (2018). Expression pattern of endogenous PAR-4A & C after CRISPR/Cas9-mediated genome editing. microPublication Biology. 10.17912/micropub.biology.000075.
Download: RIS BibTeX