Methods

Molecular cloning:

pcGAL0073 (Pceh-63::cGAL) driver plasmid was constructed from pcGAL0013 (Prab-3::cGAL) vector (Wang et al., 2017). 646 bp ceh-64 promoter upstream of isoform a ATG translation start site was obtained through PCR of N2 genomic DNA using NEB Phusion High Fidelity Polymerase with the forward primer 5’ CCCGGCCGGCCGAGACCGAATCAGCACCACC 3’ and the reverse primer 5’ CCCGGCGCGCCGCTAACAACACAATGAGCAAAACAG 3’. FseI and AscI restriction sites were added to the 5’ ends of the primers in order to ligate the ceh-63 promoter PCR product into the vector. Both the vector and the ceh-63 promoter PCR product was digested for 45 min at 37°C with FseI and AscI, and ligated using NEB T4 DNA ligase. The ceh-63 promoter sequence in pcGAL0073 was confirmed by Sanger sequencing (Laragen, CA).

Injection mix:  25 ng/μl of pcGAL0073 was mixed with 30 ng/μl of Punc-122::gfp co-injection marker and 145 ng/μl of 1kb DNA ladder carrier (NEB, MA). The mixture was injected into fifteen N2 animals and a stable extrachromosomal array line was obtained for integration by X-ray irradiation (Evans 2006), generating syIs530.

Florescence imaging: DVC neuron was imaged using Zeiss Imager Z2 under a Zeiss Imager Z2 with an Apotome 2.0 and a 100x oil objective using Zen Blue 2.3.