A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects

Currey, Heather; Liachko, Nicole

Heather Currey1 and Nicole Liachko1,2

1Geriatrics Research Education and Clinical Center, Veterans Affairs Puget Sound Health Care System, Seattle, WA 98108, USA
2Division of Gerontology and Geriatric Medicine, Department of Medicine, University of Washington, Seattle, WA 98104, USA

Correspondence to: Nicole Liachko (nliachko@uw.edu)

Figure 1: cdc-7(tm4391) but not cdc-7(knu709) is temperature-sensitive sterile. (A) Schematic of cdc-7 gene locus and location of tm4391 and knu709 deletions. knu709 deletes 2,284 nucleotides, beginning 163 nucleotides upstream of the cdc-7 ATG start and ending 136 nucleotides downstream of the cdc-7 TAA stop, within the cdc-7 3’UTR. This deletion does not impact upstream or downstream genes. (B) cdc-7(tm4391) worms are temperature sensitive sterile, with higher temperatures being progressively worse for fecundity. At 25^oC, 90% of individual worms tested were sterile (Total n= 48. Number of plates with progeny = 3, number without progeny = 45). There was an intermediate effect at 20^oC with 56% sterility (Total n= 49. Number of plates with progeny = 21, number without progeny = 28). cdc-7(tm4391) was most fertile when kept at 16^oC, with only 30% sterility (Total n= 49. Number of plates with progeny = 35, number without progeny = 14). N2 controls had no observed sterility at any temperatures (for 25^oC, 20^oC and 16^oC respectively, total n= 50, 50, 50. Number of plates with progeny = 50, 50, 50). (C) cdc-7(knu709) were substantially less likely to be infertile and infertility did not correspond to temperature (for 25^oC, 20^oC and 16^oC respectively, percent sterile = 0%, 10%, 4%. Total n= 50, 49, 45. Number of plates with progeny = 48, 44, 43. Number of plates without progeny = 0, 5, 2).

Description

CDC7 regulates both DNA replication initiation and checkpoint-regulated progression of the cell cycle during the G1/S phase, contributes to DNA recombination and damage repair, and is an essential gene in many species (Yamada et al. 2014). In C. elegans, there has been a single characterized deletion allele available, tm4391, impacting the 8-exon coding sequence of cdc-7. tm4391 is missing 315 bp including part of exon 2, all of exon 3, and part of exon 4, and resulting in a downstream frame shift. cdc-7(tm4391) worms are temperature sensitive sterile, with worse fertility at higher temperatures (Figure 1B). We generated a novel deletion allele knu709, which is an approximately 2200 bp deletion spanning 150 bp upstream of exon 1 to about 150 bp after exon 8 and removing the entire cdc-7coding sequence. We tested knu709 for temperature sensitive sterility. Surprisingly, this strain is not temperature sensitive sterile (Figure 1C), indicating that the fertility defects of tm4391 may be due to either a closely linked mutation in another gene or an unexpected gain-of-function or partial loss-of-function phenotype of cdc-7(tm4391) not recapitulated by a true loss-of-function mutation.

Reagents

Strains:

CK609 cdc-7(tm4391) I – outcrossed 4x to N2.

NLS1 cdc-7(knu709) I – outcrossed 3x to N2. Strain will be sent to CGC.

Methods

Request a detailed protocol

Genotyping:

Oligos used for genotyping tm4391: Mix all 3 primers in a single reaction. Expect sizes 757bp and 270bp WT, 400bp mutant.

NL93 (F): tcagtgcaacatgcagaaca

NL94 (R): tgacacaaaccaatcccaaa

NL187 (internal deletion): ATGCGACAGCATAAAGCAAA

Oligos used for genotyping knu709: Mix all 3 primers in a single reaction. Expect sizes 2848bp and 823bp WT, 565bp mutant.

NL429 (F): cccgtatcacacactcatcg

NL430 (R): attgctaaaacccgcagaaa

NL431 (internal deletion): ggaaacgtaccctcgcctat

Fertility Assays

Synchronized populations of C. elegans were established by treating with alkaline hypochlorite solution (bleaching) (Porta-de-la-Riva et al. 2012). Eggs were grown at 16^oC to L4 stage at which point worms were singled onto 60mm NGM plates seeded with OP50. Plates with singled worms were then divided into 3 groups of approximately 50 per strain. Groups were transferred to the assay temperature: either 25^oC, 20^oC or 16^oC. After 1 week, plates were scored for the presence of progeny. The absence of progeny was scored as sterile.

CRISPR/Cas9

COP1803 cdc-7(knu709) was generated by Knudra Transgenics/ NemaMetrix (Eugene, OR), and the deletion end-points confirmed by sequencing. 3-frame stop insertion sequence at breakpoints of deletion: TAAATAAATAAACTCGAG.

Acknowledgments

We thank Drs. Brian Kraemer and Tom Bird for expert advice. We thank the National Bioresource Project (Japan) for providing strains. We thank WormBase for C. elegans model organism information. We thank the Department of Veterans Affairs for funding.

Author Contributions: N.L. was involved in this project conceptualization, formal analysis, methodology, project administration, resources, supervision, visualization and writing. H.C. was involved in project conceptualization, formal analysis, investigation, methodology, project administration, visualization and writing.

References

Porta-de-la-Riva, M., L. Fontrodona, A. Villanueva and J. Ceron, 2012. Basic Caenorhabditis elegans methods: synchronization and observation. J Vis Exp: e4019. PMID: 22710399

10.3791/4019 | PubMed

Yamada, M., H. Masai and J. Bartek, 2014. Regulation and roles of Cdc7 kinase under replication stress. Cell Cycle 13: 1859-1866.

10.4161/cc.29251 | PubMed

Funding

Department of Veterans Affairs Career Development Award 2 #I01BX007080 and Merit Review Grant #I01BX004044 to N.L.

Reviewed By

Kelly Liu

History

Received: December 28, 2018
Accepted: January 3, 2019
Published: January 3, 2019

Copyright

© 2019 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Currey, H; Liachko, N (2019). A CRISPR/Cas9-generated cdc-7 loss of function mutation does not cause temperature-dependent fertility defects. microPublication Biology. 10.17912/micropub.biology.000085.
Download: RIS BibTeX