microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Two new CRISPR-generated alleles in...
Two new CRISPR-generated alleles in the C. elegans mir-1022 gene.
Connor Horn1, Robert Sholl1, Dustin Haskell1, Shilpa Hebbar1 and Anna Zinovyeva1
1Division of Biology, Kansas State University, Manhattan, KS
Correspondence to: Anna Zinovyeva (zinovyeva@ksu.edu)
These authors contributed equally.
Figure 1: Using CRISPR/Cas9, two mir-1022 deletions/insertions (indels), zen97 and zen98, were generated. (A) A schematic of the C. elegans mir-1022 locus. The location of zen97 and zen98 deletions are designated by the blue and yellow rectangle, respectively. (B) The genetic sequence of the zen97 and zen98 deletions' endpoints in the mir-1022 locus, with the deletions represented by the ellipsis. Insertion sequence within each allele is in brackets.

Description

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression during animal development. Large scale efforts to identify functions of individual miRNAs or miRNA families provide invaluable insight into the roles these miRNAs play in organism development (Miska et al. 2007, Alvarez-Saavedra and Horvitz 2010), however, some miRNA genes lack deletion alleles. To our knowledge, no alleles in C. elegans mir-1022 gene are currently available.

Using CRISPR/Cas9 genome editing technique, we generated two novel alleles in the mir-1022 locus in C. elegans (Fig 1A). The zen97 allele is a 498 pair deletion of the mir-1022 locus which also inserts GAGGGGATT into that locus (Fig 1B). The zen98 allele is a 508 base pair deletion from the mir-1022 locus, inserting CGGTGTACAATGTATACAATGT in that location (Fig 1B).

To specifically target the mir-1022 locus for editing, we used the following guide RNAs: mir-1022_gRNA 1: 5’-TCGGGCCAACACATTTCAG-3′ and mir-1022_gRNA 2: 5’-TTTGCGTGCGAAAGTGGTGA-3′. The primers used for PCR genotyping were mir-1022.for3: 5’-CTAGTGCATTGTCCAGGCAG-3′ and mir-1022.rev3: 5’-CGTGATCTCTTGGTGCACAT-3’. The Co-CRISPR marker dpy-10 was used in order to more easily identify worms with active CRISPR/Cas9 as previously described (Arribere et al. 2014). CRISPR components were injected into N2 animals as an RNP complex (Paix et al. 2015). Alt-R Cas9 (cat# 1081058), mir-1022 and dpy-10 Alt-R® CRISPR-Cas9 crRNAs (custom), and tracer RNA (cat# 1072532) were purchased from IDT. PCR screening identified two independent mutations, each disrupting the mir-1022 locus (Fig 1), which were subsequently homozygosed and sequenced. UY262 mir-1022(zen97) did not segregate any dumpy, dumpy roller, or roller animals and was not outcrossed. mir-1022(zen98) was outcrossed once to wild type (N2) males to remove a background dpy-10 mutation, generating the 1x outcrossed UY286 mir-1022(zen98) strain. Sequencing was repeated to confirm the mutation.

Both alleles are homozygous viable. While not extensively characterized, no gross morphological phenotype was produced by either mir-1022 allele. Further phenotypic analysis will be necessary to determine the exact effect of the two mir-1022 mutations.

Reagents

UY262 mir-1022(zen97) and UY286 mir-1022(zen98) (1x outcrossed) are available upon request.

Acknowledgments

These deletions were created during the course of BIOL676 Molecular Genetics at Kansas State University. We thank the Fall 2019 BIOL676 section students for their assistance with screening.

References

Miska EA, Alvarez-Saavedra E, Abbott AL, Lau NC, Hellman AB, McGonagle SM, et al. (2007). “Most Caenorhabditis elegans microRNAs Are Individually Not Essential for Development or Viability.” PLoS Genet 3(12): e215.
10.1371/journal.pgen.0030215 | PubMed
Alvarez-Saavedra E, Horvitz HR (2010). “Many families of C. elegans microRNAs are not essential for development or viability.” Curr Biol 20(4):367-73.
10.1016/j.cub.2009.12.051 | PubMed
Arribere JA, Bell RT, Fu BX, Artiles KL, Hartman PS, Fire AZ (2014). “Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans.” GENETICS 198(3): 837-846.
10.1534/genetics.114.169730 | PubMed
Paix A, Folkmann A, Rasoloson D, Seydoux G (2015). “High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes.” GENETICS 201(1): 47-54.
10.1534/genetics.115.179382 | PubMed

Funding

Funding for BIOL676 is provided by Kansas State University. This work was in part supported by R35GM124828 to A.Z.

Author Contributions

Connor Horn: Investigation, Writing - original draft
Robert Sholl: Investigation, Writing - original draft
Dustin Haskell: Investigation, Supervision
Shilpa Hebbar: Investigation, Supervision
Anna Zinovyeva: Supervision, Writing - review and editing, Resources, Funding acquisition.

Reviewed By

Katherine McJunkin

History

Received: February 5, 2020
Accepted: March 27, 2020
Published: April 1, 2020

Copyright

© 2020 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Horn, C; Sholl, R; Haskell, D; Hebbar, S; Zinovyeva, A (2020). Two new CRISPR-generated alleles in the C. elegans mir-1022 gene.. microPublication Biology. 10.17912/micropub.biology.000233.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430