microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / A role for Arabidopsis myosins...
A role for Arabidopsis myosins in sugar-induced hypocotyl elongation
Damilola Olatunji1 and Dior R Kelley1
1Iowa State University
Correspondence to: Dior R Kelley (dkelley@iastate.edu)
Figure 1: (A) Schematic gene structure of ATM1 (AT3G19960) indicating the T-DNA insertions assayed in this study: SAIL_405_B08 (atm1-1), SALK_127305 (atm1-2), GABI_209H11 (atm1-3), and SALK_022962 (atm1-4). Black boxes and lines depict exons and introns respectively. Scale bar is 100 bases. (B) ATM1 transcript levels in different alleles (atm1-1, atm1-2, atm1-3, and atm1-4) compared to Columbia Ecotype (Col-0) assayed by quantitative PCR (qPCR). (C) Average hypocotyl length of seedlings grown on 0.5X Murashige and Skoog (MS) medium with or without 15 mM sucrose in the dark for 5 days. A total of 30-40 seedlings were evaluated and the assay was replicated three times (panel shows the results from one experiment). Error bars show standard error. P values are calculated using one- or two-way ANOVA followed by Tukey multiple comparisons; ns: not significant. (D) Hypocotyl phenotypes after 5 days of incubation in continuous darkness. Scale bar: 5mm

Description

The ability of developing seedlings to respond and adapt to diverse environmental conditions including light is critical for their emergence and establishment (Benvenuti et al., 2001; Forcella et al., 2000; Salter et al., 2003; Yu and Huang, 2017). Cell expansion within the hypocotyl optimizes light and energy capture by the cotyledons, and enables the transition to autotrophic status (Botterweg-Paredes et al., 2020; Dowson‐Day and Millar, 1999; Oh et al., 2013). Hypocotyl elongation is regulated by multiple factors including temperature, phytohormones, circadian clock and light (Dowson‐Day and Millar, 1999; Ma et al., 2016; Procko et al., 2014; Reed et al., 2018; Yu and Huang, 2017). Endogenous and exogenous sugars are also important regulators of hypocotyl cell expansion (Lilley et al., 2012; Liu et al., 2011; Pfeiffer and Kutschera, 1995; Simon et al., 2018b; Singh et al., 2017; Zhang et al., 2010, 2015). Under constant darkness, the interaction between plant hormones such as brassinosteroid and gibberellin and sugar signalling is proposed to stimulate increase in hypocotyl length (Simon et al., 2018b; Zhang et al., 2010, 2015). Hypocotyl phenotypes are important tools in plant biology as they have been used to screen for mutants with altered responses to light and sugar signalling and some of the identified genes have revolutionized plant research (Nakano, 2019). In multicellular organisms, actomyosin-dependent transport constitutes an essential component of the cellular structure and dynamics (Duan and Tominaga, 2018; Kurth et al., 2017; Peremyslov et al., 2010). The Arabidopsis genome encodes 17 myosins classified into two distantly-related groups comprising 4 class VIII myosins and 13 class XI plant myosins (Haraguchi et al., 2019; Reddy and Day, 2001; Ryan and Nebenführ, 2018). The plant-specific-myosin XI has been implicated in diverse developmental processes (Cai et al., 2014), but the contribution of members of class VIII myosins including myosin1/ATM1 to plant development stills remains elusive.

Here, we analyzed the role of plant myosins in sucrose-induced hypocotyl elongation under continuous darkness conditions. To start the molecular characterization of ATM1 (AT3G19960), we analyzed four T-DNA insertional alleles (Fig. 1A), and mutations were confirmed via PCR-based genotyping. We also performed RT-qPCR to quantify ATM1 transcripts in the four alleles, of which atm1-1 (SAIL_405_BO8 previously described by Haraguchi et al., 2014) showed reduced ATM1 expression among these alleles compared to the wild type (Fig. 1B). Notably, atm1-3 exhibits increased mRNA levels and may be a overexpression allele. Since atm1-1 had the lowest ATM1 transcript level, and was previously described as a null (Haraguchi et al., 2014) we decided to use this allele for further phenotypic analysis. To understand the contribution of plant myosins in sugar-regulated hypocotyl cell expansion we performed growth assays using Col-0 (WT: wild-type), atm1-1, a class XI myosin single gene mutant (xik) and the triple knockout line (3KO; xi1 xi2 xik). This triple mutant was previously generated using SALK insertion lines in XI-K (SALK_067972; At5g20490), XI-1 (SALK_019031; At1g17580) and XI-2 (SALK_055785; At5g43900) (Prokhnevsky et. al., 2008; Valera et. al., 2010). All genotypes were grown on 0.5X Murashige and Skoog (MS) medium without or with 15 mM sucrose under constant darkness for 5 days. Under the sucrose-free condition (control), all the three myosin mutants showed reduced hypocotyl length compared to the WT plants (Fig. 1C and D), suggesting the role of myosins in cell elongation. Specifically, the 3KO mutant was severely impaired in hypocotyl cell expansion in the absence of sucrose when compared to the single mutants, hinting that this gene family may redundantly regulate plant development. In the presence of sucrose under constant darkness, the short hypocotyl phenotype was not fully rescued when compared to the WT plants except for atm1-1.

Altogether our findings suggest that plant-specific myosins may be involved in sugar-regulated hypocotyl elongation under continuous darkness. These myosins have diverse subcellular localization patterns (Haraguchi et al., 2014; Peremyslov et al., 2012, 2008) and thus may represent a new downstream signaling output following sucrose signals within the developing shoot. Sucrose-induced hypocotyl elongation has been linked to brassinosteroid, gibberellins, phytochrome interacting factors (PIFs) and SnRK1 (Sucrose Nonfermenting Kinase 1) signaling (Laxmi et al., 2004; Liu et al., 2011; Simon et al., 2018a; Zhang et al., 2015, 2010; Zhang and He, 2015). Other proteins that are important for this process include TANG1 (Zheng et al., 2015), a WD40 protein AtGHS40 (Hsiao et al., 2016), a plant-specific protein SR45 (Carvalho et al., 2010), and HIGH SUGAR RESPONSE 8 (HSR8) (Li et al., 2007). Further studies will be needed to determine how these molecular factors work in concert or parallel to regulate skotomorphogenesis.

Methods

Request a detailed protocol

Plant materials

Arabidopsis thaliana plants used in this study were Columbia (Col-0) ecotype: SAIL_405_B08 (atm1-1), SALK_127305C (atm1-2), GABI_219H11(atm1-3) and SALK_022962C (atm1-4) and previously described (xik) and 3KO triple knockout line (xi1 xi2 xik) (Peremyslov et al., 2012, 2010, 2008). Seeds were surfaced sterilized using 50% bleach and 0.01% Triton X-100 for 10 min and then washed five times with sterile water. Seeds were then imbibed in sterile water for 2 days at 4 °C and then transferred to 0.5X Murashige and Skoog (MS) medium plates supplemented without/with 15mM sucrose. For hypocotyl elongation, plates were incubated in the light for 6 hours prior to incubation in the dark for 5 days at 22 °C. PCR based genotyping of the mutants was performed with primers listed in Table 1 and 2X DreamTaq polymerase master mix (Thermo Fisher Scientific).

Real time quantitative PCR (RT-qPCR)

Plant materials were harvested from 7-day old seedlings in three biological replicates. RNA samples were extracted with ZYMO RESARCH Direct-zol RNA Miniprep Plus Kit and quality was spectrophotometrically measured with the Nanodrop. cDNA synthesis was performed with SuperScript IV Reverse Transcriptase kit according to manufacturer’s instruction. The samples were run on BIO RAD CFX Connect Real-Time PCR Detection System with the following components per reaction of 20µL volume: 10µL iTaq Universal SYBR Green Supermix, 0.6 µL Forward Primer F (300nM), 0.6 µL Reverse Primer F (300nM) and 3µL cDNA (5ng/ul). No cDNA samples (water) were included as negative control. Cycling conditions were 5 min at 95 °C, followed by cycles of 15 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C. Data acquisition was done at the end of every cycle. The samples were prepared in three biological and two technical repeats. The Comparative CT Method (ΔΔ CT Method) was used for the analysis of Ct values whereby the amount of target, normalized to an endogenous reference and relative to a calibrator and is given by 2 –ΔΔCT.

Hypocotyl length and statistical analysis

Five-day old dark-grown seedlings were imaged using an Epson Perfection V600 Photo Scanner. Hypocotyl length was measured with ImageJ. For each experimental treatment, 30-40 seedlings were measured for each genotype. The assays were repeated three independent times with similar results. GraphPad Prism (GraphPad Software, version 8.4.2) was used for statistical analysis. To compare treatments effects on the mean value of wild type and mutants, either or one- or two-way ANOVA was performed using Tukey’s test for multiple comparison.

Gene diagram annotation

The diagram of ATM1 (AT3G19960) was created using the Exon-Intron Graphic Maker (http://wormweb.org/exonintron) using current gene model sequence from TAIR (www.arabidopsis.org). The position of all T-DNA alleles examined was obtained from the SALK SIGnAL T-DNA express Arabidopsis Gene Mapping tool (http://signal.salk.edu/cgi-bin/tdnaexpress).

Reagents

Table 1: Primers used in this study.

Primers 5′ > 3′ Sequence Purpose
SAIL_405_B08 LP TTCGTGTGAACGTTGATTCTG Genotyping
SAIL_405_B08 RP TCCAGCTTGAATAGATGACGG
SALK_127305_LP TCCTCAAGCATCACCGTTAAC
SALK_127305_RP GCAGAGAGCTCAAGTGTTTGG
GABI_219H11_LP TAAGAGCGAGACAGAGAACCG
GABI_219H11_RP TCGTGGTTGGTTGGTTAGAAG
SALK_022962_LP GGGGAAACAGAGAGAAATTGG
SALK_022962_RP TTTGCTTTGGCATTAACCAAC
Sail-LB2 GCTTCCTATTATATCTTCCCAAATTACCAATACA
LBb1.3 ATTTTGCCGATTTCGGAAC
GABI-8474 ATAATAACGCTGCGGACATCTACATTTT
ATM1_qPCR_Fw CAGACAGAGAACTGAGGAGGC RT-qPCR
ATM1_qPCR_Rv CATCGAACCACTGCTCTCTTCG
AT1G13320_Fw GCGGTTGTGGAGAACATGATACG
AT1G13320_Rv GAACCAAACACAATTCGTTGCTG

Acknowledgments

We wish to thank Valerian Dolja (Oregon State University) for sharing seed stocks of the previously described (xik) and 3KO triple knockout lines (xi1 xi2 xik) (Peremyslov et al., 2008). All other seed stocks were obtained from the ABRC (Arabidopsis Biological Resource Center at Ohio State University).

References

Benvenuti, S., Macchia, M., Miele, S., 2001. Light, temperature and burial depth effects on Rumex obtusifolius seed germination and emergence. Weed Res. 41, 177–186.
https://doi.org/10.1046/j.1365-3180.2001.00230.x
Botterweg-Paredes, E., Blaakmeer, A., Hong, S.-Y., Sun, B., Mineri, L., Kruusvee, V., Xie, Y., Straub, D., Ménard, D., Pesquet, E., Wenkel, S., 2020. Light affects tissue patterning of the hypocotyl in the shade-avoidance response. PLOS Genet. 16, e1008678.
PubMed
Cai, C., Henty-Ridilla, J.L., Szymanski, D.B., Staiger, C.J., 2014. Arabidopsis Myosin XI: A Motor Rules the Tracks. Plant Physiol. 166, 1359 LP – 1370.
PubMed
Carvalho, R.F., Carvalho, S.D., Duque, P., 2010. The plant-specific SR45 protein negatively regulates glucose and ABA signaling during early seedling development in Arabidopsis. Plant Physiol. 154, 772–783.
PubMed
Dowson‐Day, M.J., Millar, A.J., 1999. Circadian dysfunction causes aberrant hypocotyl elongation patterns in Arabidopsis. Plant J. 17, 63–71.
PubMed
Duan, Z., Tominaga, M., 2018. Actin-myosin XI: an intracellular control network in plants. Biochem. Biophys. Res. Commun. 506, 403–408.
PubMed
Forcella, F., Benech Arnold, R.L., Sanchez, R., Ghersa, C.M., 2000. Modeling seedling emergence. F. Crop. Res. 67, 123–139.
https://doi.org/10.1016/ S0378-4290(00) 00088-5
Haraguchi, T., Duan, Z., Tamanaha, M., Ito, K., Tominaga, M., 2019. Diversity of Plant Actin–Myosin Systems BT - The Cytoskeleton: Diverse Roles in a Plant’s Life. In: Sahi, V.P., Baluška, F. (Eds.), . Springer International Publishing, Cham, pp. 49–61.
Haraguchi, T., Tominaga, M., Matsumoto, R., Sato, K., Nakano, A., Yamamoto, K., Ito, K., 2014. Molecular characterization and subcellular localization of Arabidopsis class VIII myosin, ATM1. J. Biol. Chem. 289, 12343–12355.
PubMed
Hsiao, Y.-C., Hsu, Y.-F., Chen, Y.-C., Chang, Y.-L., Wang, C.-S., 2016. A WD40 protein, AtGHS40, negatively modulates abscisic acid degrading and signaling genes during seedling growth under high glucose conditions. J. Plant Res. 129, 1127–1140.
PubMed
Kurth, E.G., Peremyslov, V. V, Turner, H.L., Makarova, K.S., Iranzo, J., Mekhedov, S.L., Koonin, E. V, Dolja, V. V, 2017. Myosin-driven transport network in plants. Proc. Natl. Acad. Sci. 114, E1385 LP-E1394.
PubMed
Laxmi, A., Paul, L.K., Peters, J.L., Khurana, J.P., 2004. Arabidopsis constitutive photomorphogenic mutant, bls1, displays altered brassinosteroid response and sugar sensitivity. Plant Mol. Biol. 56, 185–201.
PubMed
Li, Y., Smith, C., Corke, F., Zheng, L., Merali, Z., Ryden, P., Derbyshire, P., Waldron, K., Bevan, M.W., 2007. Signaling from an altered cell wall to the nucleus mediates sugar-responsive growth and development in Arabidopsis thaliana. Plant Cell 19, 2500–2515.
PubMed
Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., Nemhauser, J.L., 2012. An endogenous carbon-sensing pathway triggers increased auxin flux and hypocotyl elongation. Plant Physiol. 160, 2261–2270.
PubMed
Liu, Z., Zhang, Y., Liu, R., Hao, H., Wang, Z., Bi, Y., 2011. Phytochrome interacting factors (PIFs) are essential regulators for sucrose-induced hypocotyl elongation in Arabidopsis. J. Plant Physiol. 168, 1771–1779.
PubMed
Ma, D., Li, X., Guo, Y., Chu, J., Fang, S., Yan, C., Noel, J.P., Liu, H., 2016. Cryptochrome 1 interacts with PIF4 to regulate high temperature-mediated hypocotyl elongation in response to blue light. Proc. Natl. Acad. Sci. 113, 224–229.
PubMed
Nakano, T., 2019. Hypocotyl Elongation: A Molecular Mechanism for the First Event in Plant Growth That Influences Its Physiology. Plant Cell Physiol. 60, 933–934.
PubMed
Oh, S., Warnasooriya, S.N., Montgomery, B.L., 2013. Downstream effectors of light- and phytochrome-dependent regulation of hypocotyl elongation in Arabidopsis thaliana. Plant Mol. Biol. 81, 627–640.
PubMed
Peremyslov, V. V, Klocko, A.L., Fowler, J.E., Dolja, V. V, 2012. Arabidopsis Myosin XI-K Localizes to the Motile Endomembrane Vesicles Associated with F-actin. Front. Plant Sci. 3, 184.
PubMed
Peremyslov, V. V, Prokhnevsky, A.I., Avisar, D., Dolja, V. V, 2008. Two class XI myosins function in organelle trafficking and root hair development in Arabidopsis. Plant Physiol. 146, 1109–1116.
PubMed
Peremyslov, V. V, Prokhnevsky, A.I., Dolja, V. V, 2010. Class XI Myosins Are Required for Development, Cell Expansion, and F-Actin Organization in Arabidopsis. Plant Cell 22, 1883 LP – 1897.
PubMed
Pfeiffer, I., Kutschera, U., 1995. Sucrose metabolism and cell elongation in developing sunflower hypocotyls. J. Exp. Bot. 46, 631–638.
https://doi.org/10.1093/jxb/46.6.631
Pollard, T.D., Cooper, J.A., 2009. Actin, a central player in cell shape and movement. Science 326, 1208–1212.
PubMed
Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., Chory, J., 2014. Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa. Plant Physiol. 165, 1285 LP – 1301.
PubMed
Prokhnevsky A.I., Peremyslov V.V., Dolja V.V., 2008. Overlapping functions of the four class XI myosins in Arabidopsis growth, root hair elongation, and organelle motility. Proc Natl Acad Sci U S A. 105(50):19744-19749.
PubMed
Reddy, A.S., Day, I.S., 2001. Analysis of the myosins encoded in the recently completed Arabidopsis thaliana genome sequence. Genome Biol. 2.
PubMed
Reed, J.W., Wu, M.-F., Reeves, P.H., Hodgens, C., Yadav, V., Hayes, S., Pierik, R., 2018. Three auxin response factors promote hypocotyl elongation. Plant Physiol. 178, 864–875.
PubMed
Ryan, J.M., Nebenführ, A., 2018. Update on Myosin Motors: Molecular Mechanisms and Physiological Functions. Plant Physiol. 176, 119 LP – 127.
PubMed
Salter, M.G., Franklin, K.A., Whitelam, G.C., 2003. Gating of the rapid shade-avoidance response by the circadian clock in plants. Nature 426, 680–683.
PubMed
Simon, N.M.L., Kusakina, J., Fernández-López, Á., Chembath, A., Belbin, F.E., Dodd, A.N., 2018a. The Energy-Signaling Hub SnRK1 Is Important for Sucrose-Induced Hypocotyl Elongation. Plant Physiol. 176, 1299–1310.
PubMed
Simon, N.M.L., Sawkins, E., Dodd, A.N., 2018b. Involvement of the SnRK1 subunit KIN10 in sucrose-induced hypocotyl elongation. Plant Signal. Behav. 13, e1457913.
PubMed
Singh, M., Gupta, A., Singh, D., Khurana, J.P., Laxmi, A., 2017. Arabidopsis RSS1 Mediates Cross-Talk Between Glucose and Light Signaling During Hypocotyl Elongation Growth. Sci. Rep. 7, 16101.
PubMed
Yu, Y., Huang, R., 2017. Integration of ethylene and light signaling affects hypocotyl growth in Arabidopsis. Front. Plant Sci. 8, 57.
PubMed
Zhang, Y., He, J., 2015. Sugar-induced plant growth is dependent on brassinosteroids. Plant Signal. Behav. 10, e1082700–e1082700.
PubMed
Zhang, Y., Liu, Z., Wang, J., Chen, Y., Bi, Y., He, J., 2015. Brassinosteroid is required for sugar promotion of hypocotyl elongation in Arabidopsis in darkness. Planta 242, 881–893.
PubMed
Zhang, Y., Liu, Z., Wang, L., Zheng, S., Xie, J., Bi, Y., 2010. Sucrose-induced hypocotyl elongation of Arabidopsis seedlings in darkness depends on the presence of gibberellins. J. Plant Physiol. 167, 1130–1136.
PubMed
Zheng, L., Shang, L., Chen, X., Zhang, L., Xia, Y., Smith, C., Bevan, M.W., Li, Y., Jing, H.-C., 2015. TANG1, Encoding a Symplekin_C Domain-Contained Protein, Influences Sugar Responses in Arabidopsis. Plant Physiol. 168, 1000–1012.
PubMed

Funding

This work was supported by an American Association of University Women Research Publication Grant to D.R.K. and Iowa State University start-up funds to D.R.K.

Author Contributions

Damilola Olatunji: Conceptualization, Writing - original draft, Writing - review and editing, Formal analysis, Methodology, Investigation, Validation, Visualization
Dior R Kelley: Conceptualization, Writing - original draft, Writing - review and editing, Visualization, Funding acquisition, Resources, Supervision.

Reviewed By

Michelle Facette and Anonymous

History

Received: June 11, 2020
Revision received: July 3, 2020
Accepted: July 7, 2020
Published: July 10, 2020

Copyright

© 2020 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Olatunji, D; Kelley, DR (2020). A role for Arabidopsis myosins in sugar-induced hypocotyl elongation. microPublication Biology. 10.17912/micropub.biology.000276.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430