Description

Mechanisms of chemotactic behaviors have been of great interest in C. elegans neuroscience since the early days of its research (Ward 1973). Lewis and Hodgkin (1977) systematically isolated more than ten abnormal chemotaxis (che) mutants that showed defective chemotaxis to sodium (Na⁺) and chloride (Cl^–) ions (Lewis and Hodgkin 1977), whose responsible genes have already been molecularly characterized except for che-5(e1073). We here show that che-5(e1073) is a missense allele of gcy-22, which encodes a receptor guanylyl cyclase (rGC) specifically expressed in the ASE-right (ASER) gustatory neuron and is essential for chemosensation through the neuron.

C. elegans is attracted to the NaCl concentration at which it has experienced with food, while avoid the concentration at which it has experienced starvation. ASER plays a major role in food-associated salt concentration chemotaxis; input of salt information into ASER is required and sufficient for chemotaxis to the salt concentration associated with food (Kunitomo et al. 2013). ASE neurons, consisting of bilaterally symmetrical ASE-left (ASEL) and ASER, are the major sensory neuron for water-soluble attractants (Bargmann and Horvitz 1991). They respectively sense different sets of ions such as Na⁺ and Cl^– (Pierce-Shimomura et al. 2001; Suzuki et al. 2008; Ortiz et al. 2009). A cyclic GMP (cGMP) signaling pathway consisting of rGCs and TAX-4/TAX-2 cyclic nucleotide-gated ion channels mediates sensory transduction in ASE (Coburn and Bargmann 1996; Komatsu et al. 1996; Ortiz et al. 2009). ASEL and ASER express distinct sets of rGCs (Ortiz et al. 2006). Of these, gcy-22 is essential for ASER to respond to multiple ion species; therefore it is proposed as a common component of chemoreceptor complexes (Ortiz et al. 2009; Adachi et al. 2010; Smith et al. 2013). To further elucidate the mechanisms of chemosensation through ASER, we characterized as yet uncloned che-5. We focused on che-5 because CB1073 che-5(e1073) mutant, the unique strain/allele of the gene, showed chemotaxis defects characteristic of ASER-specific malfunction; a severe defect in attraction to Cl^–, whereas relatively moderate defect in Na⁺ chemotaxis (Lewis and Hodgkin 1977).

We mapped the mutation of che-5(e1073) responsible for salt chemotaxis defect between genetic positions 24.52 (single nucleotide polymorphism (SNP): WBVar00240760) and 25.54 (SNP: WBVar00053592) on chromosome V by using SNPs between N2 and CB4856 (Wicks et al. 2001). The mapped region contained an ASER-specific chemotaxis gene, gcy-22 (genetic position: 25.28). This result was unexpected from the initial report that mapped e1073 on chromosome IV (Lewis and Hodgkin1977), but consistent with a recent observation in which whole-genome sequencing failed to identify a mutation corresponding to che-5(e1073) on chromosome IV (Smith et al. 2013).

gcy-22(tm2364) harbors a deletion in the middle of gcy-22 coding region that results in a frame shift and therefore is a putative null allele (Fig. 1A). Salt concentration chemotaxis of the animals heterozygous for e1073 and tm2364 showed that the two alleles failed to complement each other, indicating that these alleles affect the same locus (Fig. 1B). Nucleotide sequencing of the gcy-22 locus revealed that e1073 carried ACG GCA CCA AAG CAC ATT AGA in which the adenine residue in bold letter was guanine in wild type (Fig. 1A). This transition results in a missense change E697K in GCY-22 isoform a. The glutamate residue is located in the kinase-like domain and well conserved in rGC proteins. In addition, CB1073 carried another nucleotide substitution within the first intron of gcy-22, TAAACTATGTAAGAAATTTCC, in which the adenine residue in bold letter was guanine in wild type (Fig. 1A). Furthermore, expression of a cDNA for gcy-22a in CB1073 in ASER-specific manner completely rescued the salt chemotaxis defect of the mutant (Fig. 1C). These results strongly indicate that che-5 is allelic to gcy-22 and the chemotaxis defect of e1073 is due to the mutations of gcy-22 locus.