microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Creation of a functional unc-11/PICALM...
Creation of a functional unc-11/PICALM GFP knock-in by CRISPR
Maria Gallegos1, Alex Hermes1 and Debjani Patra1
1California State University, East Bay
Correspondence to: Maria Gallegos (maria.gallegos@csueastbay.edu)
These authors contributed equally.

Abstract

unc-11 is the only C. elegans ortholog of mammalian PICALM/AP180, paralogs that play an important role in Clathrin-Mediated Endocytosis (CME) and the recycling of a subset of SNAREs, the vesicle-associated membrane proteins (VAMPs). In this publication we report the creation of a new unc-11 allele that is endogenously-tagged with GFP just upstream of the stop codon. Moreover, we demonstrate that the UNC-11::GFP fusion protein functions like wild type with an expression pattern similar to UNC-11 antibody staining described previously.

Figure 1. A functional GFP knock-in at the C-terminus of UNC-11 localizes to intracellular puncta in various cell types: (A) A representative image of the anterior portion of an L4 unc-11(vg103) hermaphrodite expressing UNC-11::GFP (green) captured at 63X magnification. Blue is autofluorescence. The arrowhead points to the nerve ring and the asterisks point to coelomocytes. Scale bar indicates 20 microns. (B) Thrash duration in seconds was measured for each genotype during a 45 second interval for 9 worms each. See methods for more details. (C-F) Representative images of an L4 unc-11(vg103) hermaphrodite also captured at 63X magnification. Scale bar indicates 5 microns. (C) The developing vulva, (D) a coelomocyte (autofluorescence in blue), (E) the epithelial surface of the head and (F) the epithelial surface of the body centered over the seam cell membranes.

Description

UNC-11 is an ortholog of mammalian PICALM (phosphatidylinositol binding clathrin assembly protein) and its neuron-specific paralog, AP180 (Maritzen et al. 2012). PICALM facilitates recycling of Vesicle Associated Membrane Proteins (VAMPs) from the plasma membrane (Miller et al. 2011, Sahlender et al. 2013 and Miller et al. 2015) and efficient clathrin-coated endocytosis (Huang et al. 2004, Miller et al. 2015 and Ishikawa et al. 2014). unc-11 function in C. elegans is likely conserved as SNB-2 (VAMP2) and the glutamate receptor, GLR-1, both accumulate at the plasma membrane in unc-11(e47) null mutants (Nonet et al. 1999, Burbea et al. 2002). Mutant phenotypes outside the worm nervous system have not been described.

To determine the endogenous expression pattern and subcellular localization of unc-11, we created a functional GFP knock-in at the endogenous unc-11 locus using the CRIPSR approach outlined by Dickinson et al. 2015. Specifically, a GFP::AID::3xFLAG coding sequence interrupted by four synthetic introns was inserted just 5′ to the unc-11 stop codon. Successful knock-in was verified by sequencing the insertion junctions and expression of GFP.

To ask if the addition of GFP at the C-terminus of UNC-11 compromises unc-11 function we performed a thrashing assay to examine the general health of the nervous system (Figure 1B). We compared the thrash duration (see methods) of unc-11(+) with the CRISPR knock-in strain, unc-11(vg103) and the null mutant, unc-11(e47). We found no obvious differences between unc-11(+) and unc-11(vg103). Average thrash duration during a 45 second interval was 0.251 seconds (n=9, Std. Dev. = 0.042) for unc-11(+) and 0.248 seconds (n=9, Std. Dev. = 0.031) for unc-11(vg103). By contrast, the average thrash duration for unc-11(e47) was significantly higher at 0.566 seconds with a striking increase in variability (n=9, Std. Dev. = 0.196).

In general, UNC-11::GFP expression matched that of UNC-11 antibody staining described previously (Nonet et al. 1999) with some noted exceptions. Similar to UNC-11 antibody staining, UNC-11::GFP expression appeared pan-neuronal and was also observed within coelomocytes (Figure 1A and 1D). Not described by Nonet el al 1999, we observed GFP puncta in apical epithelial tissue just below the cuticle surface in both the head and in the body (Figure 1E and 1F), an accumulation of UNC-11::GFP at the plasma membrane in the seam cells (Figure 1F) and weak staining in the vulval precursor cells (VPCs) at the interface between the VPCs and the vulval lumen (Figure 1C). Finally, Nonet et al. described diffuse staining within the intestine whereas we did not observe detectable levels of intestinal expression, punctate or otherwise (Figure 1A).

Plasmid construction was done in the context of a course entitled Advanced Molecular Techniques at California State University, East Bay. This strain will be made available at the CGC. Given the inclusion of an AID tag and GFP, this strain will be useful for cell-specific protein degradation using auxin-inducible (AID) or GFP nanobody::ZIF-1 degradation methods (Wang et al. 2007 and Zhang et al. 2015).

Methods

Request a detailed protocol

Thrashing Assay: Individual worms were placed on a glass slide with a 3% agar pad and about 75 ul of M9 buffer. Slides were then mounted onto a DIY microscope (original design by Kenji Yoshino) and videos were captured at 30 frames per second using an iPhone 7. To open the images in FIJI, the .MOV files were converted to an uncompressed AVI format using ff.WORKS software. The duration of each thrash was measured in FIJI by logging each frame number at which the worm completed a single body bend in one direction. Thrash duration (in seconds) was then calculated as the number of frames per body bend divided by 30 frames per second. Approximately, 1450 frames (~45 seconds) of video were reviewed for each animal. Body bends that did not fall below 150 degrees were not counted as a true body bend. When a body bend angle was suspected to be greater than 150 degrees, the angle ruler in Fiji (Image J) was used. Brief intervals where thrashing occurred along the Z-axis or the worm left the field of view were not included. The data was graphed using Plots of Differences available at https://huygens.science.uva.nl/PlotsOfDifferences/ (Joachim Goedhart, 2019).

Confocal Microscopy: unc-11(vg103) animals were anesthetized with sodium azide (10 mM) and imaged using a Leica SP8 confocal. To visually distinguish true GFP signal from intestinal autofluorescence for Figures 1A and 1D, Z-stacks were captured using a sequential scanning protocol: Seq 1: The 488 laser was set at 2.4%. PMT1 (green) collected wavelengths from 494 to 544 nm (capturing GFP and autofluorescence) while PMT2 (blue) collected wavelengths from 650 to 798 nm (autofluorescence only). Seq 2: The 552 laser was set at 1.0 % and PMT1 (blue) collected wavelengths from 598 to 709 nm (autofluorescence only). Adjustments were made to brightness and contrast of the blue channels to bring out the autofluorescence then the green and blue channels were combined and relevant focal planes were subject to maximum projection. The other images did not emit detectable autofluorescence and so the blue channel images were not included in the Z projection.

Reagents

The sgRNA/Cas9 plasmid (pDQ1022) was created by Q5 SDM (NEB) using pJW1219 as template (a plasmid containing sgRNA(F+E) and Peft-3::Cas9; Addgene # 61250) and the following primer pair: CGACTAGACTATAATCCAAAgtttaagagctatgctggaa and caagacatctcgcaatagga. The unc-11 target sequence is in all caps and the position of the unc-11 STOP codon is in bold. The GFP::SEC repair template (pDQ1023) was created by Gibson Assembly of pJW1583 (A GFP^SEC^AID*::3xFLAG vector with ccdB sites for cloning homology arms; Addgene # 121054) digested with AvrII and SpeI and two unc-11 homology arms (HA) amplified by PCR (Q5 DNA polymerase – NEB). Primers used to amplify the 5’HA and 3’HA homology arms from wild type genomic DNA include: ACGACGGCCAGTCGCCGGCATGCGATGGGTTAGTTTATCG and CCTGAGGCTCCCGATGCTCCTAATCCAAATGGATCGGCTG (5’HA); AGGATGACGATGACAAGAGATAGTCTAGTCGTCTATTTCTC and TATGACCATTTATCGATTTCGCAATAGAGATAAAGTTGCA (3’HA). unc-11(vg103[unc-11::gfp]) (DQ3188) was created as described by Dickinson et al. 2015. Successful knock-in was verified by PCR amplification and sequencing of the junction fragments and by GFP expression.

Acknowledgments

We thank Dr. Jordan Ward for technical advice during course development and Dr. Noelle L’Etoile for advice during manuscript preparation.

References

Burbea M, Dreier L, Dittman JS, Grunwald ME, Kaplan JM. 2002. Ubiquitin and AP180 regulate the abundance of GLR-1 glutamate receptors at postsynaptic elements in C. elegans. Neuron 35: 107-20.
PubMed
Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200: 1035-49.
PubMed
Goedhart, J. 2019. PlotsOfDifferences – a web app for the quantitative comparison of unpaired data. BioRxiv.
https://doi.org/10.1101/578575
Huang F, Khvorova A, Marshall W, Sorkin A. 2004. Analysis of clathrin-mediated endocytosis of epidermal growth factor receptor by RNA interference. J Biol Chem 279: 16657-61.
PubMed
Ishikawa Y, Maeda M, Pasham M, Aguet F, Tacheva-Grigorova SK, Masuda T, Yi H, Lee SU, Xu J, Teruya-Feldstein J, Ericsson M, Mullally A, Heuser J, Kirchhausen T, Maeda T. 2015. Role of the clathrin adaptor PICALM in normal hematopoiesis and polycythemia vera pathophysiology. Haematologica 100: 439-51.
PubMed
Maritzen T, Koo SJ, Haucke V. 2012. Turning CALM into excitement: AP180 and CALM in endocytosis and disease. Biol Cell 104: 588-602.
PubMed
Miller SE, Mathiasen S, Bright NA, Pierre F, Kelly BT, Kladt N, Schauss A, Merrifield CJ, Stamou D, Höning S, Owen DJ. 2015. CALM regulates clathrin-coated vesicle size and maturation by directly sensing and driving membrane curvature. Dev Cell 33: 163-75.
PubMed
Miller SE, Sahlender DA, Graham SC, Höning S, Robinson MS, Peden AA, Owen DJ. 2011. The molecular basis for the endocytosis of small R-SNAREs by the clathrin adaptor CALM. Cell 147: 1118-31.
PubMed
Nonet ML, Holgado AM, Brewer F, Serpe CJ, Norbeck BA, Holleran J, Wei L, Hartwieg E, Jorgensen EM, Alfonso A. 1999. UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol Biol Cell 10: 2343-60.
PubMed
Sahlender DA, Kozik P, Miller SE, Peden AA, Robinson MS. 2013. Uncoupling the functions of CALM in VAMP sorting and clathrin-coated pit formation. PLoS One 8: e64514.
PubMed
Wang S, Tang NH, Lara-Gonzalez P, Zhao Z, Cheerambathur DK, Prevo B, Chisholm AD, Desai A, Oegema K. 2017. A toolkit for GFP-mediated tissue-specific protein degradation in C. elegans. Development 144: 2694-2701.
PubMed
Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142: 4374-84.
PubMed

Funding

The Department of Biology paid for the reagents used in the lab course, Biol 622.

Author Contributions

Maria Gallegos: Data curation, Conceptualization, Project administration, Supervision, Writing - original draft
Alex Hermes: Data curation
Debjani Patra: Data curation.

Reviewed By

Diana Chu

History

Received: April 7, 2021
Revision received: April 19, 2021
Accepted: April 19, 2021
Published: April 28, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Gallegos, M; Hermes, A; Patra, D (2021). Creation of a functional unc-11/PICALM GFP knock-in by CRISPR. microPublication Biology. 10.17912/micropub.biology.000389.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430