microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Improved GAL4 and Tet OFF...
Improved GAL4 and Tet OFF drivers for C. elegans bipartite expression
Michael Nonet1
1Washington University School of Medicine, St Louis, MO, USA
Correspondence to: Michael Nonet (nonetm@wustl.edu)

Abstract

The first generation of C. elegans GAL4 drivers for bipartite expression function less well than C. elegans tet ON/OFF, QF and LexA drivers. The main difference between the GAL4 drivers and the others is the absence of a flexible linker between the DNA binding and activation domain in the GAL4 construct. Addition of a linker to a GAL4-QF construct increased driver potency, while adding linkers to a GAL4-VP64 driver was much less effective. Extending the linker region of the tetR-L-QF driver also increased activity of that driver. The new GAL4 driver makes GAL4/UAS bipartite system activity comparable to the other worm bipartite expression systems.

Figure 1. GAL4SK and TetR bipartite driver activity improves with a flexible linker: Quantification of GFP expression of various GAL4SK and TetR bipartite drivers with distinct linkers separating the DNA and activation domains. The mec-4 promoter was used to express the drivers. An 11X UAS ∆pes-10p GFP-C1 reporter was used to assay GAL4SK activity and a 7X tetO ∆pes-10 GFP-C1 reporter was used to assay TetR activity. See strain list for the exact genotype of animals analyzed. Individual measurements (filled grey circles) and the mean (black bar) are shown. The units are defined identically for ALM and PLM measurements. All of the transgenes also express in AVM and PVM. None of the transgenes express in any other cell types to detectable levels. Strains used: NM5225, NM5467, NM5468, NM5301, NM5470, NM5233 and NM5362. n=15-17 for ALM and 30-34 for PLM. T-test: p*<0.01, ** p<0.0001.

Description

Several bipartite systems have been described for use with C. elegans (Wei et al., 2012; Wang et al., 2017; Wang et al., 2018; Mao et al., 2019; Nonet, 2020). However, little manipulation of the drivers or reporters has been performed to optimize them for C. elegans. Mao. et. al. 2019 demonstrated that the QF activation domain is a more potent activator than either VP64 or the hybrid VP64-p65-Rta tripartite activatorVPR. Here, I describe modifications of linker region between the activation domains of both GAL4SK and TetR drivers that increase the activity of these reporters. Although these studies are not comprehensive, I opted to describe them herein because the modification of the GAL4SK driver increases the activity of this driver substantially such that it is now on par with the LexA, TetR and QF2 drivers.

I used an efficient RMCE protocol (Nonet, 2020) to create the transgenic animals. Modified versions of a mec-4 promoter GAL4SK-QFAD, GAL4SK-VP64 and TetR-QFAD constructs were created in an RMCE integration vector using a Golden Gate cloning approach, then integrated on Chr IV using a standard injection protocol. After outcrossing to the appropriate reporter, the expression level of GFP at steady state in PLM and ALM soma of L4 animals was quantified (Figure 1).

Previously, I described drivers consisting of C. elegans codon optimized synthetic GAL4SK, TetR and LexA DNA binding domains fused to the QF activation domain based on the observations of Mao. et al. 2019. Although the GAL4SK construct was modestly active, the LexA and TetR construct were incapable of activating the reporter (supplemental methods of Nonet, 2020). Replacement of a 49 amino acid portion of central domain of QF, which separates the TetR and LexA DNA binding domains and the QF activation domain in the original constructs, with a 12 amino acid flexible linker converted both into much stronger drivers than the GAL4SK-QFAD driver (Nonet, 2020). Here I show that insertion of a similar linker also greatly increases the potency of the GAL4SK-QFAD driver. I also extended the linker of the TetR-L-QFAD and this further improved activity of this driver. In Nonet, 2020, I also tested the functionality of a GAL4SK-VP64 construct (Wang et al. 2017) in single copy and found it was incapable of expressing the GFP reporter. To test if the failure of GAL4SK-VP64 was also the result of insufficient domain separation, I inserted a 40 amino acid flexible linker in between GAL4 and VP64. Although the linker containing driver activates transcription, it does so extremely poorly in comparison to the GAL4SK-QFAD drivers. I speculate this is likely due to the loss of the MED25 subunit of the mediator complex in the nematode lineage (Grants et al., 2015). VP64 (a 4X VP16) is known to activate transcription in part through interaction with MED25 (Mittler et al., 2003) and the loss of this interaction could account for the observed weak activation properties of VP64 and related activators in worms (Mao et al. 2019 and herein).

In addition to the modification of the linker domain of the transgenes I characterize herein, some of the transgenes also differ in other ways that could theoretically impact my conclusions. First, some driver transgenes contain a tbb-2 3′ UTR and others use an act-4 3′ UTR. I consider it very unlikely these differences impact GFP expression for two reasons. First, my lab has previously demonstrated that mec-4promoter driven GFP-C1 transgenes employing the tbb-2 3′ UTR and the act-4 3′ UTR express at very similar levels in ALM and PLM (Dour and Nonet, 2021). More importantly, I previously demonstrated that the activity of the both a GAL4-QFAD driver and a LexA-L-QFAD driver are insensitive to dosage of the driver (Figure 5 of Nonet, 2020). Specifically, GFP levels observed in GAL4SK/+; UAS::GFP ~= GALSK; UAS::GFP. Thus, the level of expression of the driver is unlikely to be determining the GFP signal level. Rather, I speculate that GAL4SK is saturating the UAS binding sites in all transgenes and that the inherent activation properties of the driver determines the expression level.

Second, all drivers were integrated at jsTi1493 except for the inactive linkerless TetR-QFAD driver. I present data on integration of NMp3730 (mec-4p tetR-QFAD tbb-2 3′ UTR) at jsTi1490 (Nonet, 2020). I also previously created insertions of the same plasmid at jsTi1493 IV and jsTi1492 II (jsSi1531 [mec-4p tetR-QFAD tbb-2 3′] IV and jsSi1534 [mec-4p tetR-QFAD tbb-2 3′] II; Table S1 and Table S5 in Nonet, 2020). The GFP expression was undetectable in jsSi1531/+; jsSi1519 [7X tetO ∆pes-10p GFP]/+ and jsSi1534/+;jsSi1519/+ double heterozygote animals. However, only the jsTi1490 transgene was homozygosed with the reporter. Thus, I quantified that insertion. However, this difference is highly unlikely to impact my findings as the other two insertions are qualitatively completely inactive.

The improvements to GAL4SK-QFAD by insertion of a flexible linker is an important addition to the C. elegans bipartite expression toolkit since the GAL4 system is so extensively developed in Drosophila. Using multi-copy lines and a VP64 activator, Wang et al. (2018) have already shown that the split GAL4SK system is functional in worms. Incorporation of a similar flexible linker and a QF activation domain into those tools should permit development of a robust single copy split-GAL4SK system. Other GAL4 system tools previously developed for Drosophila such as GAL80ts and GAL4-PR tools (Caygill and Brand, 2016) which provide temporal control in addition to spatial control could also easily be incorporated into the worm toolbox.

In addition, further manipulation of the size and properties of the linker domain separating the DNA binding domain and activation domains could yield drivers with even stronger activation proper which would likely also be applicable to the LexA, QF and Tet ON/OFF driver/reporter systems.

Methods

Request a detailed protocol

Methods

C. elegans was maintained on NGM agar plates spotted with OP50 at 22.5°C or at 25°C during the RMCE protocol.

RMCE transgenesis

Inserts were cloned into pLF3FShC (Addgene # 153083; Nonet, 2020) and injected at ~50 ng/µl into jsTi1493 young adults. Integrants were identified and isolated as described in detail in Nonet (2020). The GAL4SK drivers were crossed to jsSi1518 [11X UAS ∆pes-10 GFP-C1] and the TetR strains were crossed to jsSi1543 [7X tetO ∆mec-7p GFP-C1].

Microscopy

For quantification of GFP signals, homozygous L4 hermaphrodite animals were mounted on 2% agar pads in a 2 µl drop of 1mM levamisole in phosphate buffered saline and imaged on an Olympus (Center Valley, PA) BX-60 microscope equipped with a Qimaging (Surrey, BC Canada) Retiga EXi monochrome CCD camera, a Lumencor AURA LED light source, Semrock (Rochester, NY) GFP-3035B and mCherry-A-000 filter sets, and a Tofra (Palo Alto, CA) focus drive, run using micro-manager 2.0ß software (Edelstein et al., 2014) using a 40X air lens at 20% LED power with 50 ms exposures. PLM soma and ALM soma signals were quantified using the FIJI version of ImageJ software (Schindelin et al., 2012) as described in Nonet (2020).

Plasmid constructions

Integration vectors were assembled using Golden Gate (GG) reactions as described in Nonet (2020). Other plasmids were constructed using standard cloning techniques.

The following were used:

NMp3055 DR274 U6 (Table S3 and Supplemental methods of Nonet, 2020)

NMp3401 DR274 CT linker

NMp3055 was digested with EcoRI and HindIII and the double stranded (ds) oligonucleotide NMo5948/49 was ligated into the vector.

NMp3403 DR274 CT-FP linker

NMp3055 was digested with EcoRI and HindIII and the ds oligonucleotide NMo5952/53 was ligated into the vector.

NMp3498 DR274 FP linker

NMp3403 was modified by DpnI-mediated mutagenesis using oligonucleotides NMo6120/21.

NMp3610 syn Gal4SK DB (Table S3 and Supplemental methods of Nonet, 2020)

NMp3617 pSAP mec-4p GALSK-VP64 (Table S3 and Supplemental methods of Nonet, 2020)

NMp3643 pLF3FShC Available at Addgene. (Table S3 and Supplemental methods of Nonet, 2020)

NMp3735 DR274 5’arm- CT mec-4p (Table S3 and Supplemental methods of Nonet, 2020)

NMp3736 DR274 TGG GGT mec-4p (Table S3 and Supplemental methods of Nonet, 2020)

NMp3751 DR274 AAG GTA act-4 3’UTR (Table S3 and Supplemental methods of Nonet, 2020)

NMp3777 DR274 3’arm tbb-2 UTR (Table S3 and Supplemental methods of Nonet, 2020)

NMp3808 DR274 CT-NT linker-QFAD (Table S3 and Supplemental methods of Nonet, 2020)

NMp3821 DR274 FP tetR(iS)-L-QFAD (called DR274 FP tetR(iS)-L-QF in Table S3 and Supplemental methods of Nonet, 2020)

NMp3876 pLF3FShC mec-4p GAL4SK-L-QFAD

NMp3736, NMp3610, NMp3808 and NMp3777 were co assembled into NMp3643 using a SapI GG reaction.

NMp4045 DR274 FP tetR-LL-QFAD

NMp3821 was amplified with oligonucleotides NMo6867 and NMo7056, DpnI digested, purified, kinased, and religated.

NMp4048 pLF3FShC mec-4p tetR-LL-QFAD act-4

NMp3735, NMp4045, and NMp3751 were co assembled into NMp3643 using a SapI GG reaction.

NMp4049 pLF3FShC mec-4p GAL4SK-L4-VP64 tbb-2 3’UTR

NMp3736, NMp3610, NMp3401, NMp3498, NMp3777, the ds oligonucleotide NMo6866/67, and VP64 as a PCR product amplified from NMp3617 using oligonucleotides NMo6404/7057 were co assembled into NMp3643 using a SapI GG reaction.

Oligonucleotides

NMo number Sequence
5948 AATTGCTCTTCgGCGGGCAGCGGTGGCAGTGGAGGTACCGGCGGAAGCGGTATGcGAAG
5949 AGCTCTTCgCATACCGCTTCCGCCGGTACCTCCACTGCCACCGCTGCCCGCcGAAGAGC
5952 AATTGCTCTTCgGGTGGCAGCGCTGGAGGTACCGGCGGTAGTGCCGGAGGCACGcGAAG
5953 AGCTCTTCgCGTGCCTCCGGCACTACCGCCGGTACCTCCAGCGCTGCCACCcGAAGAGC
6120 GCTCTTCAATGGCCGGCTCCGCCGGCTCT
6121 CGGAGCCGGCCATTGAAGAGCAATTCAAAAATCATACC
6404 CAAGCTCTTCGCGTTTAGTTAATCAGCATGTCCAGG
6866 AAGGGAGGAGCGGGTTCTGGATCTGGATCTGGAGGTTCC
6867 ACCGGAACCTCCAGATCCAGATCCAGAACCCGCTCCTCC
7056 GGTGGCAGCGCTGGAGGTACCGGCGGTAGTGCCGGAACGggtcgtcaacttga
7057 AATGCTCTTCaGGTGGCAGCGCTGGAGGTACCGGCGGTTCTGGTGGCGGAGGG

 

Transgenes

Name Description Full Designation Comments
jsTi1493 IV Chr IV landing site jsTi1493 [mosL loxP mex-5p FLP sl2 mNeonGreen rpl-28p FRT GFP-HIS-58 FRT3 mosR] IV Nonet, 2020
jsSi1515 IV mec-4p::GAL4SK-QFAD jsTi1493 jsSi1515 [mosL loxP mec-4p GAL4SK-QFAD tbb-2 3′ FRT3 mosR] IV Nonet, 2020
jsSi1516 IV mec-4p::tetR-QFAD jsTi1490 jsSi1516 [mosL loxP mec-4p tetR-QFAD tbb-2 3′ FRT3 mosR] IV Nonet, 2020
jsSi1518 I 11X UAS::GFP jsTi1453 jsSi1518 [mosL loxP 11X UAS ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I Nonet, 2020
jsSi1519 I 7X tetO ∆pes-10::GFP jsTi1453 jsSi1519 [mosL loxP 7X tetO ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I Nonet, 2020
jsSi1525 IV mec-4p::GAL4SK-VP64 jsTi1493 jsSi1525 [mosL loxP mec-4p GAL4SK-VP64 tbb-2 ‘3 FRT3 mosR] IV Nonet, 2020
jsSi1543 I 7X tetO ∆mec-7p::GFP jsTi1453 jsSi1543 [mosL loxP tetO 7X ∆mec-7p GFP-C1 tbb-2 3′ FRT3 mosR] I Nonet, 2020
jsSi1560 IV mec-4p::tetR-L-QFAD jsTi1493 jsSi1560 [mosL loxP mec-4p tetR-L-QFAD act-4 3′ FRT3 mosR] IV Nonet, 2020
jsSi1588 IV mec-4p::GAL4SK-L-QFAD jsTi1493 jsSi1588 [mosL loxP mec-4p GAL4SK-L-QFAD act-4 3′ FRT3 mosR] IV RMCE insertion of NMp3876 into jsTi1493
jsSi1661 IV mec-4p::tetR-L-QFAD jsTi1493 jsSi1661 [mosL loxP mec-4p tetR-LL-QFAD act-4 3′ FRT3 mosR] IV RMCE insertion of NMp4048 into jsTi1493
jsSi1664 IV mec-4p::GAL4SK-L4-VP64 jsTi1493 jsSi1664 [mosL loxP mec-4p GAL4SK-L4-VP64 tbb-2 3’ FRT3 mosR] IV RMCE insertion of NMp4049 into jsTi1493

Worm Strains

NM strain Genotype Source
5179 jsTi1493 [mosL loxP mex-5p FLP sl2 mNeonGreen rpl-28p FRT GFP-HIS-58 FRT3 mosR] IV Nonet, 2020; CGC
5213 jsTi1453 jsSi1518 [mosL loxP 11X UAS ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I; him-8(e1489) IV Nonet, 2020
5214 jsTi1453 jsSi1519 [mosL loxP 7X tetO ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I; him-8(e1489) IV Nonet, 2020
5225 jsTi1453 jsSi1519 [mosL loxP tetO 7X ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1490 jsSi1516 [mosL loxP mec-4p tetR-QFAD tbb-2 3′ FRT3 mosR] IV This work
5233 jsTi1453 jsSi1518 loxP UAS 11X ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1515 [mosL loxP mec-4p GAL4SK-QFAD tbb-2 3’ FRT3 mosR] IV Nonet, 2020; CGC
5264 jsTi1453 jsSi1543 [mosL loxP tetO 7X ∆mec-7p GFP-C1 tbb-2 3′ FRT3 mosR] I; him-8(e1489) IV Nonet, 2020
5295 jsTi1493 jsSi1560 [mosL loxP mec-4p tetR-L-QFAD act-4 ‘3 FRT3 mosR] IV Nonet, 2020
5301 jsTi1453 jsSi1518 [mosL loxP UAS 11X ∆pes-10p GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1525 [mosL loxP mec-4p GAL4SK-VP64 tbb-2 3’ FRT3 mosR] IV Nonet, 2020
5353 jsTi1493 jsSi1588 [mosL loxP mec-4p GAL4SK-L-QFAD act-4 3′ FRT3 MosR] IV This work
5362 jsTi1453 jsSi1518 [mosL loxP UAS 11X ∆pes-10 GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1588 [mosL loxP mec-4p GAL4SK-L-QFAD act-4 3′ FRT3 mosR] IV This work
5467 jsTi1453 jsSi1543 [mosL loxP tetO 7X ∆mec-7p GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1560 [mosL loxP mec-4p tetR-L-QFAD act-4 3’ FRT3 mosR] IV This work
5468 jsTi1453 jsSi1543 [mosL loxP tetO 7X ∆mec-7p GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1661 [mosL loxP mec-4p tetR-LL-QFAD act-4 3′ FRT3 mosR 3′ ] IV This work
5470 jsTi1453 jsSi1518 [mosL loxP UAS 11X ∆pes-10 GFP-C1 tbb-2 3′ FRT3 mosR] I; jsTi1493 jsSi1664 [mosL loxP mec-4p GAL4SK-L4–QFAD tbb-2 3’ FRT3 mosR] IV This work

Reagents

Plasmids and worm strains are available by request from MLN and will be submitted to Addgene and the Caenorhabditis Genetics Center if demand levels warrant it.

References

Caygill EE, Brand AH. 2016. The GAL4 System: A Versatile System for the Manipulation and Analysis of Gene Expression. Methods Mol Biol 1478: 33-52.
PubMed
Dour S, Nonet M. 2021. Optimizing expression of a single copy transgene in C. elegans. MicroPubl Biol. May 12;2021.
10.17912/micropub.biology.000394 | PubMed
Edelstein AD, Tsuchida MA, Amodaj N, Pinkard H, Vale RD, Stuurman N. 2014. Advanced methods of microscope control using μManager software. J Biol Methods 1(2):e10.
PubMed
Grants JM, Goh GY, Taubert S. 2015. The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator. Nucleic Acids Res 43: 2442-53.
PubMed
Mao S, Qi Y, Zhu H, Huang X, Zou Y, Chi T. 2019. A Tet/Q Hybrid System for Robust and Versatile Control of Transgene Expression in C. elegans. iScience 11: 224-237.
PubMed
Mittler G, Stühler T, Santolin L, Uhlmann T, Kremmer E, Lottspeich F, Berti L, Meisterernst M. 2003. A novel docking site on Mediator is critical for activation by VP16 in mammalian cells. EMBO J 22: 6494-504.
PubMed
Nonet ML. 2020. Efficient Transgenesis in Caenorhabditis elegans Using Flp Recombinase-Mediated Cassette Exchange. Genetics 215: 903-921.
PubMed
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9: 676-82.
PubMed
Wang H, Liu J, Gharib S, Chai CM, Schwarz EM, Pokala N, Sternberg PW. 2017. cGAL, a temperature-robust GAL4-UAS system for Caenorhabditis elegans. Nat Methods 14: 145-148.
PubMed
Wang H, Liu J, Yuet KP, Hill AJ, Sternberg PW. 2018. Split cGAL, an intersectional strategy using a split intein for refined spatiotemporal transgene control in Caenorhabditis elegans. Proc Natl Acad Sci U S A 115: 3900-3905.
PubMed
Wei X, Potter CJ, Luo L, Shen K. 2012. Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Nat Methods 9: 391-5.
PubMed

Funding

WUMS department of neuroscience funds.

Author Contributions

Michael Nonet: Conceptualization, Data curation, Writing - original draft, Funding acquisition, Formal analysis.

Reviewed By

Han Wang and Anonymous

History

Received: July 3, 2021
Revision received: July 27, 2021
Accepted: September 7, 2021
Published: September 14, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Nonet, M (2021). Improved GAL4 and Tet OFF drivers for C. elegans bipartite expression. microPublication Biology. 10.17912/micropub.biology.000438.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430