microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / The odd-1(tm848) mutation has no...
The odd-1(tm848) mutation has no significant effect on brood size in Caenorhabditis elegans
Gabriella M. Scoca1 and Amy C. Groth1
1Eastern Connecticut State University
Correspondence to: Amy C. Groth (grotha@easternct.edu)

Abstract

The genome of Caenorhabditis elegans contains two genes of the odd-skipped transcription factor family, odd-1 and odd-2. In C. elegans, odd-1 is expressed in the intestine. A deletion mutant (tm848) that removes most of the odd-1 gene, including all three zinc fingers, has no significant effect on brood size when compared to wild-type worms.

Figure 1. The odd-1(tm848) mutation and its effect on brood size: A) The 989 bp wild-type odd-1 transcript codes for a 242 amino acid (a.a.) protein and contains two exons (white boxes), the second of which contains three zinc finger domains (gray boxes). The odd-1(tm848) mutation deletes most of both exons and all of the zinc fingers, and inserts one codon, resulting in a 183 bp transcript (including the stop codon) and a 60 a.a. protein. B) The brood sizes for five odd-1(+) and odd-1(tm848) worms were observed in three different experiments (a total of 15 worms were averaged for each strain). Each circle represents the brood size of an individual worm. The average is indicated on the plot by a horizontal black line. The numbers at the top of each sample group indicate the average offspring ± the standard deviation. P = 0.65 (2-tailed t-test with equal variance).

Description

Description

The odd-skipped family of transcription factors are involved in a wide variety of developmental pathways across many taxa (Tena et al. 2007; Wang et al. 2005; Coulter et al. 1990). The genome of C. elegans encodes two odd genes, odd-1 and odd-2. A deletion mutant that deletes the transcription start site of the odd-2 gene has been classified as larval lethal by the National BioResource Project (https://nbrp.jp/en/). Early larval lethality was also seen with odd-2 injection RNAi, due to defects of the developing gut (Buckley et al. 2004). Buckley et al. also reported larval lethality with odd-1 injection RNAi, but only with the full-length construct that also has high homology to the zinc finger region of odd-2. When a smaller construct that did not contain the zinc-finger region was used, lethality was not seen (Buckley et al. 2004). Buckley et al. observed gut expression in embryos and early larvae using a 2 fragment GFP co-injection method and an integrated array. However, due to silencing of expression from multicopy arrays, it is unknown whether odd-1 expresses in the germline. Mammals have two odd-skipped genes, odd-skipped-related 1 and 2 (OSR1 and 2). A phylogenetic tree based on the zinc finger region of the protein shows that odd-2 is most closely related to both mammalian genes, while odd-1 is more distantly related (Buckley et al. 2004). However, one of the human genes, OSR2, is most highly expressed in somatic and germline tissues related to reproduction, including uterus, vagina, cervix, Fallopian tube, ovary and testis (GTEx Consortium 2013). As a first step to clarifying the role of odd-1 in the life cycle and development of C. elegans, we analyzed brood size of an odd-1(tm848) complex substitution (Figure 1A). This substitution consists of an 809 bp deletion and a 3 bp insertion in the 989 bp odd-1 transcript. Of the 242 amino acids in ODD-1, the N-terminal 45 amino acids are intact, as are the last 14, and one amino acid is inserted. All three predicted zinc fingers (Buckley et al. 2004) are deleted. This mutation is a putative null, because ODD-1 would not be able to bind DNA in a site-specific manner, although it is possible that there is a function for the remaining portion of the protein. FX848 was outcrossed five times (to create strain ACG4) and then assayed for brood size. Three brood size experiments were conducted; each recorded the brood sizes of five wild-type and five odd-1(tm848) worms. No significant difference was found in brood size (P=0.65), with an average wild-type brood size of 307 ±38 and an average mutant brood size of 301 ±33 (Figure 1B). The number of offspring in odd-1 mutant worms is comparable to that of wild-type worms, indicating no obvious phenotypes affecting gamete production, egg laying or embryonic development. Additionally, no obvious early larval lethality was seen during the course of the brood size experiments, as the offspring counted on day three were generally late larvae/early adults. While low levels of lethality may be uncovered by performing a dedicated lethality assay, odd-1(tm848) does not appear to cause widespread early larval lethality, as was reported for injection RNAi of full-length odd-1 (Buckley et al. 2004).

Methods

Request a detailed protocol

Methods

The strain FX848 was obtained from the National BioResource Project and outcrossed five times. Primers AG382 (ATGACACTTCCATGGAATACCTTTC) and AG383 (TCAAATAGTAGTTACATCGATCAATGGC) were used for genotyping, yielding a 989 bp wild-type band and a 180 bp deletion band. Outcrossing was performed as follows. Homozygous FX848 worms were crossed to wild-type males. Individual male offspring were singled onto plates with wild-type L4 hermaphrodites. After offspring were seen, the male parents were genotyped to verify that they carried the mutation. In the first round of outcrossing, all of the male offspring were heterozygous; after the first round, only the plates with worms carrying the mutation were utilized. This process was repeated four more times, for a total of five outcrosses, at which point hermaphrodites were singled and genotyped once they had laid offspring. From hermaphrodites that were heterozygous for the mutation, offspring were singled and genotyped. One of the offspring that was identified as homozygous for the deletion was frozen as strain ACG4 (FX848 outcrossed 5x). The mutation was verified by amplification and sequencing using the primers AG356 (GTTCTTATTGGTTTTCTCCACTCTTTAAAATAGC) and AG382. For brood size assays, five wild-type and five ACG4 L4 worms were singled and moved to new plates every 24 hours for five days. Offspring on each plate were counted three days after the worms were initially placed on the plate. The experiment was repeated three times. The P-value was determined by a 2-tailed t-test with equal variance.

Reagents

Strains

N2: wildtype

FX848: odd-1(tm848)

ACG4: odd-1(tm848) outcrossed 5X

Acknowledgments

Strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440) and the National BioResource Project, Tokyo, Japan, with assistance from the lab of Judith Kimble.

References

Buckley MS, Chau J, Hoppe PE, Coulter DE. 2004. odd-skipped homologs function during gut development in C. elegans. Dev Genes Evol 214: 10-8.
PubMed
Coulter DE, Swaykus EA, Beran-Koehn MA, Goldberg D, Wieschaus E, Schedl P. 1990. Molecular analysis of odd-skipped, a zinc finger encoding segmentation gene with a novel pair-rule expression pattern. EMBO J 9: 3795-804.
PubMed
GTEx Consortium. 2013. The Genotype-Tissue Expression (GTEx) project. Nat Genet 45: 580-5.
PubMed
Tena JJ, Neto A, de la Calle-Mustienes E, Bras-Pereira C, Casares F, Gómez-Skarmeta JL. 2007. Odd-skipped genes encode repressors that control kidney development. Dev Biol 301: 518-31.
PubMed
Wang Q, Lan Y, Cho ES, Maltby KM, Jiang R. 2005. Odd-skipped related 1 (Odd 1) is an essential regulator of heart and urogenital development. Dev Biol 288: 582-94.
PubMed

Funding

Funding was provided by CSU-AAUP Faculty Research Grants.

Author Contributions

Gabriella M. Scoca: Investigation, Writing - review and editing
Amy C. Groth: Conceptualization, Investigation, Funding acquisition, Supervision, Writing - original draft, Writing - review and editing.

Reviewed By

Anonymous

History

Received: June 21, 2021
Revision received: August 20, 2021
Accepted: August 24, 2021
Published: September 1, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Scoca, GM; Groth, AC (2021). The odd-1(tm848) mutation has no significant effect on brood size in Caenorhabditis elegans. microPublication Biology. 10.17912/micropub.biology.000450.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430