Description

We have generated novel mutant alleles, named xc3, xc4, and xc5, of the gene cls-2 (R107.6) that encode one of the three predicted orthologs of mammalian CLASPs and of Drosophila ORBIT/MAST, microtuble-binding proteins (Akhmanova et al., 2001; Maiato et al., 2002). In C. elegans CLS-2 is required for meiosis and mitosis (Cheeseman et al., 2005; Dumont et al., 2010; Espiritu et al., 2012; Maton et al., 2015; Nahaboo et al., 2015). The alleles were isolated from gene mutations generated by Non-Homologous End Joining (NHEJ) mediated repair of Cas9-generated breaks (Dickinson et al., 2013; Ran et al., 2013). The alleles were detected by PCR using the following primers, 5’- CGATACGTCGGAGCAGAGC -3’ and 5’- CGGGGGTCGAAAATCATAAGG -3’. Next Generation Sequencing allowed us to identify 30 bp flanking sequences of the alleles xc3, xc4, and xc5 as TTGTCCAAGTCTACGTCAATCGGGCAATGT – [42 bp deletion] – AGCCCATAATTCCCCCGTATTCGTATCCCA, TCTACGTCAATCGGGCAATGTCGTCCAGTT – [3 bp deletion, 41 bp insertion (GGTCTGAATGACTTTCGCACTATTCCCCTATTCGCACGCCT)] – ATTCGCACGTATGATTCGTCGTTGCAATGT, and AACCTTGTCCAAGTCTACGTCAATCGGGCA – [111 bp deletion ] – TCATCCCTTCACTTTGTAATATAATTTTAT,  respectively.

​Based on information about cls-2 (R107.6) (WormBase, http://www.wormbase.org, WS261), the xc3, xc4, and xc5 mutant alleles effect the eighth exon and the 3’-UTR in the same way in each splicing isoform (Fig.1). In the xc3 mutant, 16 bp of the 3’UTR is deleted and a new stop codon was introduced after an 8 amino acid deletion (SSSSHSHV) of the C-terminus of the protein. In xc4 due to an insertion causing a frameshift mutation, 5 wildtype amino acids (SHSHV) from the C-terminus will be replaced by 3 amino acids (WSE). In xc5 the endogenous stop codon is deleted as well as 81 bp of the 3’UTR, while a new stop codon is introduced 21 bp after the mutation. Because of the deletion and new stop codon, in the xc5 mutant 9 amino acids (MSSSSHSHV) in the C-terminus of the protein will be replaced by 7 new amino acids (SSLHFVI). Previous researchers replaced serine residues with non-phosphorylatable alanine residues to study the effect of human CLASP2 phosphorylation (Kumar et al., 2017). The mutations we have generated have multiple serine residues deleted which presents a unique opportunity to study the effect of cls-2 (R107.6) phosphorylation. Since more of the 3’UTR is deleted in xc5 than xc3, the 3’UTR’s function could also be studied using these mutants.