microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / The Caenorhabditis elegans and Haemonchus...
The Caenorhabditis elegans and Haemonchus contortus beta-tubulin genes cannot substitute for loss of the Saccharomyces cerevisiae beta-tubulin gene
Sophia B Gibson1, Clare S Harper1,2, Laura L Lackner1 and Erik C Andersen1
1Molecular Biosciences, Northwestern University, Evanston, IL, 60208, USA
2Interdisciplinary Biological Sciences Program, Northwestern University, Evanston, IL, 60208, USA
Correspondence to: Erik C Andersen (erik.andersen@northwestern.edu)

Abstract

To better understand the mechanism of resistance caused by putative interactions between beta-tubulin and benzimidazole compounds, we sought to purify nematode-specific beta-tubulins using heterologous expression after replacement of the single Saccharomyces cerevisiae beta-tubulin gene. However, we found that haploid yeast cells containing nematode-specific beta-tubulin genes were not viable, suggesting that nematode beta-tubulin cannot substitute for the loss of the yeast beta-tubulin gene.

Figure 1. Caenorhabditis elegans and Haemonchus contortus beta-tubulin genes cannot substitute for loss of the sole Saccharomyces cerevisiae beta-tubulin TUB2: A) A phylogenetic tree of the beta-tubulin orthogroup for C. elegans, H. contortus, and S. cerevisiae is shown. The tree was created using MAFFT (Katoh et al.., 2002; Katoh & Standley, 2013) and IQ-TREE with ultrafast bootstrapping (Hoang et al., 2018; Minh et al., 2020). The tree was constructed using a LG+R3 substitution model selected by the highest Bayesian Information Criterion score using ModelFinder (Kalyaanamoorthy et al., 2017). Visualization was performed using iTOL (Letunic & Bork, 2021). B) The experimental design for replacement of S. cerevisiae TUB2 with ben-1 is shown. For C through F, PCR products were separated on a 1% agarose gel with the sizes of each band shown on the left. C) Colony PCR confirmed replacement of TUB2 with a NAT cassette. Lane 1 contained a fragment amplified from one primer downstream of TUB2 and another internal to the NAT cassette. Lane 2 is a product amplified from a sequence internal to the MAT-alpha locus, which serves as a positive control. D) Colony PCR confirmed codon-optimized ben-1 replacement at the TUB2 locus. Lane 1 corresponded to primers for an internal ben-1 fragment. Lane 2 corresponded to primers for an internal MAT-alpha sequence. E) Tetrad dissection results of ben-1 replacement diploids are shown. Six tetrads (rows 1-6) were separated into four haploid cells each (lanes A-D). F) RT-PCR results confirmed ben-1 expression in S. cerevisiae. An endpoint PCR product was amplified from cDNA reverse transcribed from RNA extracted from the ben-1 replacement sample. Lane 1 corresponded to PCR products generated using primers for an internal ben-1 fragment. Lane 2 corresponded to PCR products generated using primers for an internal MAT-alpha sequence. This figure was created using BioRender.com.

Description

Parasitic nematode infections continue to have an enormous impact on human and livestock health worldwide (Hotez et al., 2014; Kaplan & Vidyashankar, 2012). A limited arsenal of anthelmintic drugs are available to combat these infections. One of the most widely used classes is benzimidazoles (BZ), and resistance against this class is widespread (Kaplan & Vidyashankar, 2012). Previous studies to understand parasitic nematode resistance using the free-living model organism Caenorhabditis elegans showed that variation in the C. elegans beta-tubulin gene ben-1, an ortholog of beta-tubulins in parasitic nematodes, confers resistance to BZ drugs (Dilks et al., 2020; Driscoll et al., 1989; Hahnel et al., 2018). The most common missense mutation resistance alleles are F167Y, E198A, and F200Y (Avramenko et al., 2019; Mohammedsalih et al., 2020). Although computational models have predicted that these amino acids are involved in the binding of BZ compounds to beta-tubulins, the binding remains to be investigated empirically at the structural level because nematode-specific beta-tubulin structures have not been created (Aguayo-Ortiz et al., 2013; Hahnel et al., 2018). To better understand the mechanisms of resistance, we sought to obtain those crystallographic structures.

To isolate BEN-1 for crystallographic studies, tags would permit the purification of this beta-tubulin from the other five beta-tubulins in C. elegans. Unfortunately, endogenous tags of BEN-1 eliminate its function (Dilks and Andersen, unpublished results). Because of this limitation, we turned to expression of three different versions of nematode beta-tubulins, C. elegans BEN-1 and two beta-tubulin isotypes from the parasitic nematode Haemonchus contortus, in Saccharomyces cerevisiae, which has a single beta-tubulin gene (Figure 1A).

We used the following procedure to replace the S. cerevisiae beta-tubulin gene with each of the nematode beta-tubulin genes (Figure 1B). These replaced beta-tubulin genes were expressed using the native S. cerevisiae promoter. First, TUB2 was deleted in diploid BY4743 cells and replaced with the Nourseothricin N-acetyl transferase (NAT) cassette selection marker (Hansen et al., 2003). Successful deletion of one copy of the TUB2 coding sequence was verified using colony PCR of a sample that grew in the presence of NAT (Figure 1C). The NAT cassette was then substituted with yeast codon-optimized C. elegans ben-1 along with the HIS3 selection marker (Burke & Gould, 1994). Successful replacement of ben-1 at the TUB2 locus was verified using colony PCR on samples that grew in histidine-deficient conditions (Figure 1D). We sporulated diploids of the ben-1 replacement strain then dissected tetrads to identify haploid cells that contained the C. elegans beta-tubulin gene ben-1. We found that dissected tetrads gave rise to only two viable haploid cells instead of four when grown on complete media (YPD) (Figure 1E). The same result was obtained after replacement of TUB2 with either of the two H. contortus beta-tubulin isotype genes (data not shown). The two surviving colonies were also unable to grow in histidine-deficient conditions, suggesting that replacement of TUB2 with nematode beta-tubulin genes is lethal. Using RT-PCR of the heterozygous diploid strain with one copy of TUB2 and one copy of ben-1 at the TUB2 locus, we found that ben-1 mRNA was expressed (Figure 1F), suggesting that the nematode beta-tubulin is deficient at protein expression, lacks proper stability, and/or cannot function with the yeast alpha-tubulin gene. Our results indicate that nematode beta-tubulin genes can not substitute for the yeast beta-tubulin gene TUB2.

Beyond the phylogenetic difference between nematode and yeast beta-tubulins, it has been observed that the dynamics of microtubules in C. elegans greatly differ from other eukaryotes (Chaaban et al., 2018), suggesting that nematode beta-tubulins might be unsuitable replacements for yeast beta-tubulins. It is possible that both alpha- and beta-tubulin might need to be replaced by their nematode-specific versions to obtain viable yeast and allow for the characterization of benzimidazole and beta-tubulin binding to better understand the mechanism of resistance.

Methods

Request a detailed protocol

Strain Construction

S288C derivative strains BY4741 and BY4742 (Brachmann et al., 1998) were mated to make diploid BY4743.

Plasmid Construction

pFA6-NAT and pKT128

The construction for the plasmids containing the NAT cassette, pFA6-NAT, and the S. pombe HIS3 marker, pKT128, have been outlined previously (Janke et al., 2004; Sheff & Thorn, 2004).

pECA101, pECA103, and pECA103

Yeast codon optimized sequence for C. elegans ben-1 and H. contortus tbb-isotype-1 were cloned into a pUC57 vector and H. contortus tbb-isotype-2 was cloned into a pJET1.2 vector by GenScript (Piscataway, NJ) to make pECA101, pECA102, and pECA103 respectively. The plasmid was cloned into DH-alpha competent cells and prepped with a QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).

Yeast Transformation

Cells were grown overnight in YPD at 24°C, diluted to an OD of 0.15 and then grown to an OD of 0.5-1.0. Cells were resuspended in 100 mM Lithium acetate and combined with 50% PEG, 1M Lithium acetate, 10 mg/mL salmon sperm DNA, water, and the desired amplicon for integration. After incubating at 30°C for 30 minutes, DMSO was added and then reactions were heat shocked at 42°C for 15 minutes. Cells were washed and either recovered overnight in YPD and plated on YPD with NAT for NAT selection or resuspended in water and plated immediately on -HIS plates for HIS3 selection. Plates were incubated for 48 hours at 30°C.

TUB2 Knock-out

A NAT cassette sequence flanked by the beginning and end of the S. cerevisiae TUB2 sequence was amplified with pFA6-NAT and the following oligonucleotides (IDT, Coralville, IA)

oECA1756: ATGAGAGAAATCATTCATATCTCGACAGGTCAGTGTGGTACGGATCCCCGGGTTAATTAA

oECA1757: TTATTCAAAATTCTCAGTGATTGGTTCATCTTGGTTTTGTGAATTCGAGCTCGTTTAAAC

Oligonucleotides to verify NAT cassette replacement (IDT, Coralville, IA)

oECA1758: AACTGGTGCACTTAATCGCTG

oECA1759: CAATTCAACGCGTCTGTGAGG

Oligonucleotides for mating type positive control (IDT, Coralville, IA)

MAT-F: TTACTCACAGTTTGGCTCCGGTGT

MAT-R: GAACCGCATGGGCAGTTTACCTTT

Ben-1 replacement

A codon-optimized C. elegans ben-1 sequence flanked by sequence upstream and downstream of TUB2 was amplified with pECA101 and the following oligonucleotides (IDT, Coralville, IA)

oECA1762: CTACTACAACTACAAAAGCAAAATCTCCACAAAGTAATATAATGAGAGAAATTGTTCATG

oECA1763: CATAAGAAATTCGCTTATTTAGAAGTGGCGCGCCTTATTCAGCGTCACCATC

An S. pombe HIS3 selective marker was amplified with pKT128 and the following oligonucleotides (IDT, Coralville, IA)

oECA1764: GATGGTGACGCTGAATAAGGCGCGCCACTTCTAAATAAGCGAATTTCTTATG

oECA1765: AGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAATCGATGAATTCGAGCTCG

Oligonucleotides to confirm the substitution or expression of ben-1 (IDT, Coralville, IA)

oECA1769: CATACAATGCTACATTGTCAG

oECA1770: CAAAGCTCTATATGCTTGAG

Sporulation and Tetrad dissection

Cells were grown overnight in YPD at 24°C and then nitrogen starved in SPO Media at 24°C for 5-6 days until sporulated. Cells were then digested in 0.5 mg/mL zymolyase, resuspended in 1.2M sorbitol, and tetrads were dissected onto YPD plates and incubated for 48 hours at 30°C. Grown colonies were then struck on to -HIS plates and incubated overnight at 30°C.

RNA extraction and RT-PCR

Cells with ben-1 substitution were grown to an OD600 of 10 overnight in YPD at 24°C and then pelleted and resuspended in High Salt RNA Buffer (0.3 M NaCl 20 mM Tris pH 8 10 mM EDTA 1% SDS), then separated with TE-saturated Phenol:Chloroform:Isoamyl alcohol. RNA was then extracted with Chloroform, precipitated with ethanol, and resuspended in water.

RNA was converted to cDNA using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). The ben-1 verification and mating-type sequences were then amplified.

Acknowledgments

We would like to thank Conor Lee-Smith for his contributions in strain construction. We would also like to thank Janneke Wit and Clayton Dilks for their helpful suggestions for the manuscript.

References

Aguayo-Ortiz R, Méndez-Lucio O, Medina-Franco JL, Castillo R, Yépez-Mulia L, Hernández-Luis F, Hernández-Campos A. 2013. Towards the identification of the binding site of benzimidazoles to β-tubulin of Trichinella spiralis: insights from computational and experimental data. J Mol Graph Model 41: 12-9.
PubMed
Avramenko RW, Redman EM, Melville L, Bartley Y, Wit J, Queiroz C, Bartley DJ, Gilleard JS. 2019. Deep amplicon sequencing as a powerful new tool to screen for sequence polymorphisms associated with anthelmintic resistance in parasitic nematode populations. Int J Parasitol 49: 13-26.
PubMed
Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14: 115-32.
PubMed
Burke JD, Gould KL. 1994. Molecular cloning and characterization of the Schizosaccharomyces pombe his3 gene for use as a selectable marker. Mol Gen Genet 242: 169-76.
PubMed
Chaaban S, Jariwala S, Hsu CT, Redemann S, Kollman JM, Müller-Reichert T, Sept D, Bui KH, Brouhard GJ. 2018. The Structure and Dynamics of C. elegans Tubulin Reveals the Mechanistic Basis of Microtubule Growth. Dev Cell 47: 191-204.e8.
PubMed
Dilks CM, Hahnel SR, Sheng Q, Long L, McGrath PT, Andersen EC. 2020. Quantitative benzimidazole resistance and fitness effects of parasitic nematode beta-tubulin alleles. Int J Parasitol Drugs Drug Resist 14: 28-36.
PubMed
Driscoll M, Dean E, Reilly E, Bergholz E, Chalfie M. 1989. Genetic and molecular analysis of a Caenorhabditis elegans beta-tubulin that conveys benzimidazole sensitivity. J Cell Biol 109: 2993-3003.
PubMed
Hahnel SR, Zdraljevic S, Rodriguez BC, Zhao Y, McGrath PT, Andersen EC. 2018. Extreme allelic heterogeneity at a Caenorhabditis elegans beta-tubulin locus explains natural resistance to benzimidazoles. PLoS Pathog 14: e1007226.
PubMed
Hansen J, Felding T, Johannesen PF, Piskur J, Christensen CL, Olesen K. 2003. Further development of the cassette-based pYC plasmid system by incorporation of the dominant hph, nat and AUR1-C gene markers and the lacZ reporter system. FEMS Yeast Res 4: 323-7.
PubMed
Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. 2018. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol Biol Evol 35: 518-522.
PubMed
Hotez PJ, Alvarado M, Basáñez MG, Bolliger I, Bourne R, Boussinesq M, Brooker SJ, Brown AS, Buckle G, Budke CM, Carabin H, Coffeng LE, Fèvre EM, Fürst T, Halasa YA, Jasrasaria R, Johns NE, Keiser J, King CH, Lozano R, Murdoch ME, O'Hanlon S, Pion SD, Pullan RL, Ramaiah KD, Roberts T, Shepard DS, Smith JL, Stolk WA, Undurraga EA, Utzinger J, Wang M, Murray CJ, Naghavi M. 2014. The global burden of disease study 2010: interpretation and implications for the neglected tropical diseases. PLoS Negl Trop Dis 8: e2865.
PubMed
Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, Knop M. 2004. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21: 947-62.
PubMed
Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 14: 587-589.
PubMed
Kaplan RM, Vidyashankar AN. 2012. An inconvenient truth: global worming and anthelmintic resistance. Vet Parasitol 186: 70-8.
PubMed
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30: 3059-66.
PubMed
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30: 772-80.
PubMed
Letunic I, Bork P. 2021. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res gkab301.
PubMed
Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R. 2020. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol 37: 1530-1534.
PubMed
Mohammedsalih KM, Krücken J, Khalafalla A, Bashar A, Juma FR, Abakar A, Abdalmalaik AAH, Coles G, von Samson-Himmelstjerna G. 2020. New codon 198 β-tubulin polymorphisms in highly benzimidazole resistant Haemonchus contortus from goats in three different states in Sudan. Parasit Vectors 13: 114.
PubMed
Sheff MA, Thorn KS. 2004. Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21: 661-70.
PubMed

Funding

This work was supported by the National Institutes of Health NIAID R01 AI153088

Author Contributions

Sophia B Gibson: Formal analysis, Writing - original draft, Writing - review and editing, Investigation, Data curation, Visualization
Clare S Harper: Investigation, Writing - review and editing
Laura L Lackner: Conceptualization, Writing - review and editing, Supervision, Methodology
Erik C Andersen: Conceptualization, Investigation, Supervision, Writing - review and editing, Methodology, Funding acquisition.

Reviewed By

James Wasmuth

History

Received: June 7, 2021
Revision received: June 19, 2021
Accepted: June 21, 2021
Published: June 30, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Gibson, SB; Harper, CS; Lackner, LL; Andersen, EC (2021). The Caenorhabditis elegans and Haemonchus contortus beta-tubulin genes cannot substitute for loss of the Saccharomyces cerevisiae beta-tubulin gene. microPublication Biology. 10.17912/micropub.biology.000411.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430