microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Endogenous expression and localization of...
Endogenous expression and localization of HIS-72::mTurquoise2 in C. elegans
Dillon E. Sloan1 and Joshua N. Bembenek2
1University of North Carolina, Chapel Hill
2University of Michigan
Correspondence to: Joshua N. Bembenek (bembenek@umich.edu)

Abstract

To generate a non-red/green fluorescent fusion histone protein in C. elegans, we have generated a C-terminal mTurquoise2-tagged HIS-72 at the endogenous locus using CRISPR. We found that HIS-72::mTurquoise2 localizes in a similar pattern to the previously published HIS-72::GFP strain.

Figure 1. Endogenous HIS-72::linker::mTurquoise2: (A) Schematic of his-72 edit (B-F) Images of HIS-72::linker::mTurquoise2 localization: in a prometaphase I embryo (B, arrow indicates meiotic chromosomes), in an anaphase I embryo (C, arrow indicates meiotic chromosomes), at the distal gonad arm (D), in the proximal gonad arm (E), and in a 50-100 cell embryo (F). (G) HIS:-72::linker::mTurquoise2 in an adult worm.

Description

In fixed samples, chromatin is most often visualized by using a fluorescent DNA-binding dye like DAPI, which emits blue light (Kapuscinski 1995). In live fluorescence microscopy, however, a fluorescently tagged histone is often used instead. Histones form nucleosomes to package chromatin, and are involved in the organization of the genome (Chen et al. 2021). Most frequently, histones are fused to red or green fluorescent proteins, though the use of a blue or cyan fluorescent protein instead would allow for three (or more) channel imaging (Kanda et al. 1998, Das et al. 2003, Ooi et al. 2006).

We sought to generate an endogenously tagged histone line with a blue or cyan fluorescent protein. mTurquoise2 is a relatively recently engineered cyan fluorescent protein with a high quantum yield (Goedhart et al. 2012). Thus, we constructed a HIS-72::mTurquoise2 fluorescent fusion protein using a design similar to that of another group who also tagged HIS-72 (Figure 1A, Dickinson et al. 2013; see Design section). We report similar localization of HIS-72::mTurquoise2 to previously generated HIS-72 fluorescent fusion strains in most nuclei of the animal (Figure 1G). HIS-72::mTurquoise2 shows chromatin labeling in the germline and all stages of the cell cycle in the early embryo (Figure 1B-F). We observed that HIS-72::mTurquoise2 signal is significantly reduced on chromatin during the meiosis I and II divisions as compared with other stages (Figure 1B,C), which is not observed in other exogenously expressed fluorescently tagged histone lines (Bai and Bembenek 2017, Bembenek et al. 2007). This may reflect the role of different histone variants in meiotic chromosome function.

In sum, we have constructed a HIS-72::mTurquoise2 fluorescent fusion strain for use to the C. elegans community.

Methods

Request a detailed protocol

CRISPR/Cas9 Gene editing

We followed the CRISPR/Cas9 protocol generated by the Seydoux lab for C-terminal mTurquoise2 tagging of the C. elegans his-72 gene (Paix et al. 2015). The repair template was amplified from the pDD377 plasmid, a gift from Bob Goldstein (Addgene plasmid #91823). Tagging of his-72 was done in the wild type N2 background. The transgenic strain was crossed to the N2 strain for 5 generations to remove potential off target mutations. All guide RNAs and oligos were obtained commercially.

The primer sequences for amplifying the repair template are listed below:

his-72::mTurquoise2_Forward (DS_030):

TGCAACTCGCCAGACGCATCAGAGGAGAACGTGCTGGAGCATCGGGAGCCTCAGGAGCATCGATGGTAAGTAAGGGCG

his-72::mTurquoise2_Reverse (DS_031):

ATTAAAAGTGCTTCGAGAATTGGTGATGGAGCTTACTTGTAGAGCTCGTCCATTCC

The flexible linker sequence: GGAGCATCGGGAGCCTCAGGAGCATCG (AA seq: GASGASGAS)

The target sequence (minus PAM) used in the crRNA (Termed DS_g004; see Dickinson et al., 2013): GAGCTTAAGCACGTTCTCCG

NOTE: This design only tags HIS-72 isoform a (Y49E10.6a, see WormBase).

Microscopy

Gravid adult worms were mounted on agar pads according to standard methods. Imaging was performed on a spinning disk confocal system consisting of a Nikon Eclipse inverted microscope with a 60×1.40 NA objective, a CSU-22 spinning disk system, and a Photometrics EM-CCD camera from Visitech International. Images were acquired by Metamorph (Molecular Devices) and analyzed by ImageJ/Fiji Bio-Formats plugins (National Institutes of Health) (Schindelin et al. 2012). The cyan/blue channel included a 450/50 emission filter with maximum blocking at 405 nm, and maximum intensity from 425-475 nm.

Reagents

JAB191: his-72(erb77[his-72::linker::mTurquoise2])

This strain will be made available to the CGC.

Acknowledgments

We thank members of the Bembenek lab, especially Chris Turpin, for useful feedback.

References

Bai X, Bembenek JN. 2017. Protease dead separase inhibits chromosome segregation and RAB-11 vesicle trafficking. Cell Cycle 16: 1902-1917.
PubMed
Bembenek JN, Richie CT, Squirrell JM, Campbell JM, Eliceiri KW, Poteryaev D, Spang A, Golden A, White JG. 2007. Cortical granule exocytosis in C. elegans is regulated by cell cycle components including separase. Development 134: 3837-48.
PubMed
Chen P, Li W, Li G. 2021. Structures and Functions of Chromatin Fibers. Annu Rev Biophys 50: 95-116.
PubMed
Das T, Payer B, Cayouette M, Harris WA. 2003. In vivo time-lapse imaging of cell divisions during neurogenesis in the developing zebrafish retina. Neuron 37: 597-609.
PubMed
Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods 10: 1028-34.
PubMed
Goedhart J, von Stetten D, Noirclerc-Savoye M, Lelimousin M, Joosen L, Hink MA, van Weeren L, Gadella TW Jr, Royant A. 2012. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%. Nat Commun 3: 751.
PubMed
Kanda T, Sullivan KF, Wahl GM. 1998. Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Curr Biol 8: 377-85.
PubMed
Kapuscinski J. 1995. DAPI: a DNA-specific fluorescent probe. Biotech Histochem 70: 220-33.
PubMed
Ooi SL, Priess JR, Henikoff S. 2006. Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans. PLoS Genet 2: e97.
PubMed
Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201: 47-54.
PubMed
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9: 676-82.
PubMed

Funding

National Institutes of Health (R01 GM114471)

Author Contributions

Dillon E. Sloan: Data curation, Formal analysis, Investigation, Methodology, Writing - original draft, Writing - review and editing, Software
Joshua N. Bembenek: Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Writing - review and editing.

Reviewed By

Anonymous

History

Received: August 24, 2021
Revision received: September 11, 2021
Accepted: September 13, 2021
Published: September 29, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Sloan, DE; Bembenek, JN (2021). Endogenous expression and localization of HIS-72::mTurquoise2 in C. elegans. microPublication Biology. 10.17912/micropub.biology.000471.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430