microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • D. discoideum
        • Drosophila
        • Human
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
        • Biochemistry
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / An analog-sensitive allele of Aurora...
An analog-sensitive allele of Aurora kinase B is lethal in mouse
Berta N. Vazquez1,2,3, Suzanne M. Quartuccio4,2 and Karen Schindler2
1Chromatin Biology Laboratory, Josep Carreras Leukaemia Research Institute (IJC), Badalona, Barcelona, Spain
2Department of Genetics, Rutgers University, Piscataway, NJ, USA
3Departament de Biologia Cellular, Fisiologia i Immunologia, Universitat Autònoma de Barcelona (UAB), Barcelona, Spain
4Department of Biological Sciences, Seton Hall University, South Orange, NJ, USA
Correspondence to: Karen Schindler (schindler@dls.rutgers.edu)

Abstract

The mammalian genome encodes three Aurora protein kinase homologs (AURKA/B/C) which regulate chromosome segregation in nearly every cell type. AURKC expression is largely limited to meiotic cells. Because of the similarity in sequences between AURKB and AURKC, determining their separate functions during meiosis is challenging. We designed a chemical genetics approach to investigate AURKB function. Using Crispr/Cas9 genome editing in mouse, we replaced an ATP binding pocket amino acid to permit binding of cell-permeable ATP analogs. We also introduced a second site supressor mutation to tolerate the pocket enlargement. Heterozygous mice were fertile, but never produced homozygous analog-sensitive mice. Because Aurkb is an essential gene, we conclude that this analog-sensitive allele is either catalytically inactive or not fully catalytically active in mouse.

Figure 1: Generation of analog sensitive AURKB mutant mice. A) Partial protein sequence alignment of mouse (m) and human (h) Aurora B kinases. Gatekeeper and suppressor site residues are highlighted in red. Asterisks below sequences denote residue conservation. B) AURKB gene organization together with partial DNA and protein sequences of WT and analog sensitive mutant alleles. Restriction sites used for diagnosis are indicated above DNA sequences (AciI for L159 to A substitution and SphI for H255 to Y substitution). C) Sanger sequencing confirming expected DNA substitutions. D) Scheme of genotyping strategy and representative PCR result image for L159 WT and mutant allele. E) Mice heterozygous for the AURKB-AS allele were intercrossed and the progeny genotyped. A total number of 80 pups coming from 8 different crosses were analyzed. The proportion of mutant mice was compared to expected Mendelian ratios (25%, 50%, 25%) and statistical analysis was conducted with a chi-square test (P-value < 0.001 by χ2).

Description

The Aurora protein kinases (AURK) are essential regulators of chromosome segregation in mitotic and meiotic cell divisions (Carmena and Earnshaw 2003). Unlike mitotically dividing cells which express two AURKs (AURKA and AURKB), mammalian oocytes, which undergo meiosis, express three AURK homologs: AURKA/B/C (Brown et al. 2004; Nguyen et al. 2018). Because AURKC shares high sequence homology with AURKB, standard approaches such as RNAi knockdown (Chen et al. 2005; Sharif et al. 2010) and small molecule inhibition (Chen et al. 2005; Lane et al. 2010; Sharif et al. 2010; Shuda et al. 2009; Swain et al. 2008) to understand their roles do not provide the specificity required to assess non-overlapping functions. Furthermore, these kinases can compensate for one another in oocytes from mouse knockout strains (Balboula and Schindler 2014; Fernandez-Miranda et al. 2011; Nguyen et al. 2018; Schindler et al. 2012), making phenotype assessments less clear. Therefore, alternative strategies to provide specificity are needed.

Chemical genetics is a strategy that documents superior specificity in inhibiting protein kinases. This approach involves enlarging the kinase ATP-binding pocket by introduction of an amino acid substitution. This enlargement allows specific acceptance of cell-permeable, bulky ATP analog inhibitors that cannot bind other kinases in the cell (Garske et al. 2011). Although most protein kinases tolerate the ATP pocket enlargement, approximately 30% of protein kinases do not (Zhang et al. 2005). A previous report demonstrates that human AURKB ATP-pocket enlargement (Leucine 154 to Alanine) abolishes its catalytic activity. Excitingly, this activity can be rescued by mutation of a second site suppressor in the C-terminus of the kinase (Histidine 250 to Tyrosine). When HeLa and U2OS cells were transiently transfected with the analog sensitive human AURKB allele, the kinase was active and cell division was not altered (Hengeveld et al. 2012). Based on these data, we were keen to adopt this approach to study the potential unique functions of AURKB. We used Crispr/Cas9 genome editing to introduce the ATP-binding pocket point mutation (L159 in mouse) and second site suppressor mutation (H255 in mouse) into the mouse genome (Fig. 1A). After confirmation by restriction digestion (Fig. 1B) and Sanger sequencing (Fig. 1C), we obtained 4 founders (2 male, 2 female) that were heterozygous for the analog-sensitive allele on the same chromosome. To expand the colony, we set up breeding cages using the heterozygous founders. Heterozygous animals were fertile and gave birth to pups. We also crossed heterozygous pups to increase chances of obtaining homozygous animals. After genotyping 80 pups that were born to 8 heterozygous mating pairs, we did not obtain any homozygous mice; wild-type and heterozygotes were born at altered Mendelian ratios (Fig. 1D-E). Because Aurkb is an essential gene (Fernández-Miranda et al. 2011), these data indicate that this analog-sensitive allele of Aurkb is either catalytically inactive or not fully catalytically active in mouse and that it cannot be used to determine specific AURKB functions in mouse oocytes.

Reagents

C57BL/6J mice: Jackson Laboratory

Cas9 IDT

L-A RNA guide (PAM sequence in parentheses) from Sigma: ACTACTTCTACGACCAGCAG (AGG)

L-A donor oligo (mutations in lower case):
CAGGCACTAGATCCCACACCAGGTAGGCCCTGACCGTGGCAGTCCGCTGCTCATCGAAGGTCCGACTCTTCTGCAGT
TCCTTGTAGAGTTCCCCGCGAGGGGCGTATTCCgcGATTAAGTAGATtCTCTGCTGGTCGTAGAAGTAGTTGTAGAG
TTGAAGGATGTTGGGATGTCTGG

H-Y RNA guide (PAM sequence in parentheses) from Sigma: TGCCCCCAGAGATGATTGAG (GGG)

H-Y donor oligo (mutations in lower case):
TCCGACGATACGTCTCACTGTGGCTAGGGCTCTCGAAGGGTGGGTTCCCCACCATCAGTTCATAGCAGAGCACCCC
GATGCACCATAGATCTACCATTTCATTATaCATGCGgCCCTCAATCATCTCTGGGGGCAGATAGTCCAGCGTGCCG
CACATGGTCTTCCTCCTGGTGGGATGAG

Genotyping Primers:

L159A substitution

L159WT F: 5’- CCAGCAGAGGATCTACTTAATCCT -3’

L159AS F: 5’- CCAGCAGAGGATCTACTTAATCGC -3’

WT R: 5’- ATGATctgtgagggtccacacaag -3’

H255Y substitution

H255WT F: 5’- GAGATGATTGAGGGGCGCATGCAT -3’

H255Y F: 5’- GAGATGATTGAGGGGCGCATGTAT -3’

WT R: 5’- CTGGCTCCTACAGTACACAAAGG -3’

Acknowledgments

The authors acknowledge the efforts of Drs. Peter Romenienko and Ghassan Yehia at the Rutgers Cancer Institute of New Jersey Genome Editing Shared Resource for designing, testing and creating these modified mice. We also acknowledge efforts of Ms. Christine Prorock-Rogers in mouse colony husbandry and genotyping.

References

Balboula AZ, Schindler K. 2014. Selective disruption of aurora C kinase reveals distinct functions from aurora B kinase during meiosis in mouse oocytes. PLoS Genet 10: e1004194.
PubMed
Brown JR, Koretke KK, Birkeland ML, Sanseau P, Patrick DR. 2004. Evolutionary relationships of Aurora kinases: implications for model organism studies and the development of anti-cancer drugs. BMC Evol Biol 4: 39.
PubMed
Carmena M, Earnshaw WC. 2003. The cellular geography of aurora kinases. Nat Rev Mol Cell Biol 4: 842-54.
PubMed
Chen HL, Tang CJ, Chen CY, Tang TK. 2005. Overexpression of an Aurora-C kinase-deficient mutant disrupts the Aurora-B/INCENP complex and induces polyploidy. J Biomed Sci 12: 297-310.
PubMed
Fernández-Miranda G, Trakala M, Martín J, Escobar B, González A, Ghyselinck NB, Ortega S, Cañamero M, Pérez de Castro I, Malumbres M. 2011. Genetic disruption of aurora B uncovers an essential role for aurora C during early mammalian development. Development 138: 2661-72.
PubMed
Garske AL, Peters U, Cortesi AT, Perez JL, Shokat KM. 2011. Chemical genetic strategy for targeting protein kinases based on covalent complementarity. Proc Natl Acad Sci U S A 108: 15046-52.
PubMed
Hengeveld RC, Hertz NT, Vromans MJ, Zhang C, Burlingame AL, Shokat KM, Lens SM. 2012. Development of a chemical genetic approach for human aurora B kinase identifies novel substrates of the chromosomal passenger complex. Mol Cell Proteomics 11: 47-59.
PubMed
Lane SI, Chang HY, Jennings PC, Jones KT. 2010. The Aurora kinase inhibitor ZM447439 accelerates first meiosis in mouse oocytes by overriding the spindle assembly checkpoint. Reproduction 140: 521-30.
PubMed
Nguyen AL, Drutovic D, Vazquez BN, El Yakoubi W, Gentilello AS, Malumbres M, Solc P, Schindler K. 2018. Genetic Interactions between the Aurora Kinases Reveal New Requirements for AURKB and AURKC during Oocyte Meiosis. Curr Biol 28: 3458-3468.e5.
PubMed
Schindler K, Davydenko O, Fram B, Lampson MA, Schultz RM. 2012. Maternally recruited Aurora C kinase is more stable than Aurora B to support mouse oocyte maturation and early development. Proc Natl Acad Sci U S A 109: E2215-22.
PubMed
Sharif B, Na J, Lykke-Hartmann K, McLaughlin SH, Laue E, Glover DM, Zernicka-Goetz M. 2010. The chromosome passenger complex is required for fidelity of chromosome transmission and cytokinesis in meiosis of mouse oocytes. J Cell Sci 123: 4292-300.
PubMed
Shuda K, Schindler K, Ma J, Schultz RM, Donovan PJ. 2009. Aurora kinase B modulates chromosome alignment in mouse oocytes. Mol Reprod Dev 76: 1094-105.
PubMed
Swain JE, Ding J, Wu J, Smith GD. 2008. Regulation of spindle and chromatin dynamics during early and late stages of oocyte maturation by aurora kinases. Mol Hum Reprod 14: 291-9.
PubMed
Zhang C, Kenski DM, Paulson JL, Bonshtien A, Sessa G, Cross JV, Templeton DJ, Shokat KM. 2005. A second-site suppressor strategy for chemical genetic analysis of diverse protein kinases. Nat Methods 2: 435-41.
PubMed

Funding

This project was supported by funding from the National Institutes of Health: R01 GM112801 to KS. Services, results and/or products in support of the research project were generated by the Rutgers Cancer Institute of New Jersey Genome Editing Shared Resource, supported, in part, with funding from NCI-CCSG P30CA072720-5922.

Author Contributions

Berta N. Vazquez: Data curation, Formal analysis, Investigation, Methodology, Writing - review and editing
Suzanne M. Quartuccio: Writing - review and editing, Methodology, Investigation
Karen Schindler: Conceptualization, Funding acquisition, Project administration, Supervision, Writing - original draft, Writing - review and editing.

Reviewed By

Anonymous

History

Received:
Accepted: October 18, 2021
Published: November 23, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Vazquez, BN; Quartuccio, SM; Schindler, K (2021). An analog-sensitive allele of Aurora kinase B is lethal in mouse. microPublication Biology. 10.17912/micropub.biology.000491.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430